Incidental Mutation 'R1716:Myh4'
ID191040
Institutional Source Beutler Lab
Gene Symbol Myh4
Ensembl Gene ENSMUSG00000057003
Gene Namemyosin, heavy polypeptide 4, skeletal muscle
SynonymsMM, Minimsc, MYH-2B, MyHC-IIb, Minmus, MHC2B, Myhsf
MMRRC Submission 039749-MU
Accession Numbers

Genbank: NM_010855; MGI: 1339713

Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R1716 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67238029-67260446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67250309 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 732 (S732R)
Ref Sequence ENSEMBL: ENSMUSP00000127514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018632] [ENSMUST00000170942]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018632
AA Change: S732R

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018632
Gene: ENSMUSG00000057003
AA Change: S732R

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 4.7e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
Pfam:Myosin_tail_1 847 1928 2.5e-168 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170942
AA Change: S732R

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127514
Gene: ENSMUSG00000057003
AA Change: S732R

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-15 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
low complexity region 928 942 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit decreased growth and muscle defects including reduced muscle mass, muscle fiber loss, compensatory fiber hypertrophy, and impaired strength. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,082,198 T2A unknown Het
Adgrf3 T A 5: 30,197,551 Q493L probably benign Het
Ak6 T C 13: 100,655,669 S207P probably benign Het
Ang A G 14: 51,101,480 D26G probably benign Het
Ang T C 14: 51,101,500 F33L probably damaging Het
Arhgef38 T A 3: 133,140,837 Y389F probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bicd2 C A 13: 49,378,310 H343N probably benign Het
Casp4 G A 9: 5,308,919 probably null Het
Cd22 A G 7: 30,877,678 F68S probably damaging Het
Cd46 T A 1: 195,077,809 Q245L probably benign Het
Cntnap2 A T 6: 47,107,892 R1096* probably null Het
Cntnap3 A G 13: 64,762,002 V763A probably damaging Het
Cyp3a11 T C 5: 145,868,966 T171A probably benign Het
Defa30 A G 8: 21,135,415 Y65C probably damaging Het
Defb18 A T 1: 18,236,651 M27K probably benign Het
Dnah17 A G 11: 118,032,598 S4071P probably benign Het
Dnah7b T A 1: 46,191,783 D1400E probably damaging Het
Dpysl5 C T 5: 30,777,994 T147I probably benign Het
Dsg4 C T 18: 20,462,461 R574* probably null Het
Epm2a A G 10: 11,448,836 E223G probably benign Het
Etl4 T C 2: 20,743,681 S75P probably damaging Het
Fam189a1 A T 7: 64,776,885 probably null Het
Fbxw15 T A 9: 109,557,136 M312L probably benign Het
Fcgr4 C T 1: 171,020,103 T90I probably damaging Het
Fras1 T A 5: 96,552,725 D201E probably benign Het
Gadl1 A T 9: 116,006,508 K335* probably null Het
Gcsam T G 16: 45,619,993 V133G probably damaging Het
Gml G T 15: 74,813,816 L107I possibly damaging Het
Golga2 T A 2: 32,302,897 L409Q probably damaging Het
Gtf2a1l A T 17: 88,694,580 Q241L probably benign Het
Gtf3c3 A G 1: 54,399,260 Y799H probably damaging Het
Guca1b T G 17: 47,391,201 probably benign Het
Igdcc4 C A 9: 65,126,897 H617Q probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itga2b A C 11: 102,460,777 I574S probably benign Het
Kcnk7 A T 19: 5,706,831 I283F probably damaging Het
Kirrel3 T A 9: 35,023,547 L450M probably damaging Het
Lmntd1 A T 6: 145,419,874 S176R probably damaging Het
Lrrc39 C T 3: 116,579,567 T292I probably benign Het
Ltbp1 A T 17: 75,315,024 H801L probably benign Het
Macf1 T A 4: 123,401,403 Q3318L probably damaging Het
Man1b1 T A 2: 25,345,020 N282K probably benign Het
Map2k6 A T 11: 110,497,901 E223V probably damaging Het
Marf1 C A 16: 14,142,586 R531S possibly damaging Het
Mfge8 G A 7: 79,142,443 R245C probably damaging Het
Mgea5 C A 19: 45,752,174 K907N probably benign Het
Mogat1 T G 1: 78,538,044 N318K probably benign Het
Myt1l T A 12: 29,811,538 D106E unknown Het
Ndc1 T C 4: 107,384,795 F302L probably damaging Het
Ndrg4 C T 8: 95,712,328 A290V probably benign Het
Nfia A T 4: 98,063,128 K397N probably damaging Het
Nlrp4e A T 7: 23,321,033 Q315L possibly damaging Het
Olfr51 T A 11: 51,007,852 N293K probably damaging Het
Olfr9 A C 10: 128,990,852 *313C probably null Het
Peg3 T C 7: 6,707,781 I1481V possibly damaging Het
Phldb2 C T 16: 45,775,050 G883D probably benign Het
Pik3c2b T A 1: 133,094,826 Y1169N probably damaging Het
Plcl1 A T 1: 55,695,838 I113F probably damaging Het
Pomt2 T C 12: 87,124,836 I457V probably benign Het
Ppil1 T C 17: 29,261,835 N38S possibly damaging Het
Prf1 A G 10: 61,300,452 N169S probably benign Het
Prmt8 A C 6: 127,726,523 probably null Het
Ptprg T A 14: 12,154,360 S694T probably benign Het
Rab12 A T 17: 66,500,320 M138K possibly damaging Het
Reln T C 5: 21,955,095 T2159A probably damaging Het
Retsat A T 6: 72,606,080 Y36F probably damaging Het
Rgs14 A T 13: 55,378,883 Q116L probably damaging Het
Rlbp1 A T 7: 79,375,936 N252K probably damaging Het
Rtraf A G 14: 19,812,174 L215P probably damaging Het
Sec1 A T 7: 45,679,365 M86K probably benign Het
Sec24b A T 3: 130,041,016 S42T possibly damaging Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc35f5 T G 1: 125,584,532 D356E possibly damaging Het
Smpd4 T C 16: 17,642,501 S694P probably damaging Het
Spag6 G T 2: 18,745,609 probably null Het
Spata31d1c T C 13: 65,033,216 I43T possibly damaging Het
Ssh1 T C 5: 113,952,020 D314G possibly damaging Het
Tnfrsf17 G A 16: 11,319,731 D111N probably benign Het
Ttn A G 2: 76,723,291 I30994T probably damaging Het
Ttn A T 2: 76,783,976 F8737L probably damaging Het
Ush1c G T 7: 46,195,728 F890L probably benign Het
Usp36 C T 11: 118,272,131 probably null Het
Vmn2r115 T C 17: 23,347,821 Y436H probably benign Het
Vmn2r94 T A 17: 18,257,373 M259L probably benign Het
Wwp1 T C 4: 19,659,698 T197A probably benign Het
Zbtb37 T A 1: 161,020,244 M398L probably benign Het
Zfp804b C T 5: 6,769,673 C1130Y probably benign Het
Zfp9 A G 6: 118,464,751 C317R probably damaging Het
Zscan20 T C 4: 128,586,541 H719R probably damaging Het
Other mutations in Myh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Myh4 APN 11 67255379 missense probably damaging 1.00
IGL01600:Myh4 APN 11 67260189 missense possibly damaging 0.85
IGL01737:Myh4 APN 11 67243419 splice site probably benign
IGL02208:Myh4 APN 11 67251934 missense possibly damaging 0.96
IGL02334:Myh4 APN 11 67245547 missense probably damaging 1.00
IGL02376:Myh4 APN 11 67245728 missense probably benign 0.00
IGL02429:Myh4 APN 11 67258982 nonsense probably null
IGL02450:Myh4 APN 11 67251809 missense probably damaging 1.00
IGL02524:Myh4 APN 11 67249240 missense possibly damaging 0.79
IGL02612:Myh4 APN 11 67256479 missense probably benign
IGL03024:Myh4 APN 11 67248479 missense probably damaging 1.00
IGL03065:Myh4 APN 11 67259156 missense probably benign 0.12
IGL03084:Myh4 APN 11 67251951 splice site probably null
IGL03188:Myh4 APN 11 67246543 critical splice donor site probably null
IGL03204:Myh4 APN 11 67250296 missense possibly damaging 0.63
IGL03252:Myh4 APN 11 67252216 missense probably damaging 0.99
IGL03345:Myh4 APN 11 67255478 missense probably damaging 1.00
F6893:Myh4 UTSW 11 67255457 missense probably null 0.12
PIT1430001:Myh4 UTSW 11 67258832 missense probably benign 0.01
PIT4458001:Myh4 UTSW 11 67240995 missense possibly damaging 0.56
R0099:Myh4 UTSW 11 67259347 missense probably benign
R0194:Myh4 UTSW 11 67252336 missense probably damaging 1.00
R0346:Myh4 UTSW 11 67260326 missense probably benign
R0427:Myh4 UTSW 11 67258653 missense probably damaging 0.98
R0483:Myh4 UTSW 11 67252297 missense probably damaging 1.00
R0571:Myh4 UTSW 11 67250331 missense possibly damaging 0.91
R0854:Myh4 UTSW 11 67259147 missense possibly damaging 0.90
R0940:Myh4 UTSW 11 67242863 missense probably damaging 1.00
R0946:Myh4 UTSW 11 67251751 missense possibly damaging 0.70
R1108:Myh4 UTSW 11 67255706 missense probably null 0.01
R1162:Myh4 UTSW 11 67258613 missense probably damaging 0.97
R1194:Myh4 UTSW 11 67255734 critical splice donor site probably null
R1347:Myh4 UTSW 11 67244741 splice site probably benign
R1457:Myh4 UTSW 11 67248461 missense probably damaging 0.99
R1531:Myh4 UTSW 11 67250540 missense probably benign 0.01
R1766:Myh4 UTSW 11 67256295 missense possibly damaging 0.61
R1796:Myh4 UTSW 11 67260324 missense probably benign
R1856:Myh4 UTSW 11 67255682 missense probably damaging 1.00
R1873:Myh4 UTSW 11 67254743 missense probably benign 0.16
R2069:Myh4 UTSW 11 67246366 splice site probably benign
R2370:Myh4 UTSW 11 67255628 missense probably damaging 1.00
R2406:Myh4 UTSW 11 67259174 missense probably damaging 1.00
R2414:Myh4 UTSW 11 67250768 missense probably benign 0.01
R2848:Myh4 UTSW 11 67248633 missense probably benign 0.20
R3111:Myh4 UTSW 11 67246450 missense possibly damaging 0.86
R3744:Myh4 UTSW 11 67255315 missense probably damaging 1.00
R3845:Myh4 UTSW 11 67259105 missense possibly damaging 0.90
R3877:Myh4 UTSW 11 67257183 missense probably benign 0.00
R4498:Myh4 UTSW 11 67251752 missense probably damaging 1.00
R4514:Myh4 UTSW 11 67255569 missense probably benign 0.06
R4601:Myh4 UTSW 11 67250310 missense possibly damaging 0.94
R4673:Myh4 UTSW 11 67246401 missense probably benign 0.02
R4684:Myh4 UTSW 11 67245811 missense probably damaging 0.99
R4736:Myh4 UTSW 11 67240920 missense probably benign 0.01
R4837:Myh4 UTSW 11 67258992 missense probably benign 0.38
R4866:Myh4 UTSW 11 67248627 missense probably benign 0.00
R4869:Myh4 UTSW 11 67252664 missense probably damaging 1.00
R4887:Myh4 UTSW 11 67241054 missense probably damaging 0.99
R4921:Myh4 UTSW 11 67254028 missense probably damaging 1.00
R5005:Myh4 UTSW 11 67253415 missense probably benign 0.05
R5008:Myh4 UTSW 11 67253532 missense probably benign 0.00
R5011:Myh4 UTSW 11 67256363 missense probably benign 0.03
R5087:Myh4 UTSW 11 67255409 missense probably damaging 1.00
R5277:Myh4 UTSW 11 67252354 missense probably damaging 1.00
R5336:Myh4 UTSW 11 67259191 splice site probably null
R5354:Myh4 UTSW 11 67255725 missense possibly damaging 0.69
R5371:Myh4 UTSW 11 67259324 missense probably damaging 1.00
R5484:Myh4 UTSW 11 67251818 missense probably damaging 1.00
R5774:Myh4 UTSW 11 67253208 nonsense probably null
R5902:Myh4 UTSW 11 67250907 missense possibly damaging 0.69
R5941:Myh4 UTSW 11 67259300 missense probably damaging 0.99
R6045:Myh4 UTSW 11 67244724 missense probably benign 0.32
R6156:Myh4 UTSW 11 67250792 missense probably benign 0.00
R6301:Myh4 UTSW 11 67255333 missense possibly damaging 0.95
R6318:Myh4 UTSW 11 67243442 missense probably benign 0.02
R6352:Myh4 UTSW 11 67252282 missense probably damaging 1.00
R6385:Myh4 UTSW 11 67255837 missense probably damaging 1.00
R6493:Myh4 UTSW 11 67258629 missense probably benign 0.16
R6666:Myh4 UTSW 11 67251812 missense probably damaging 1.00
R6826:Myh4 UTSW 11 67246531 missense probably damaging 1.00
R6852:Myh4 UTSW 11 67252968 splice site probably null
R6857:Myh4 UTSW 11 67249885 missense possibly damaging 0.74
R7029:Myh4 UTSW 11 67246425 missense probably benign 0.40
R7076:Myh4 UTSW 11 67253173 missense possibly damaging 0.85
R7145:Myh4 UTSW 11 67260228 missense possibly damaging 0.54
R7179:Myh4 UTSW 11 67244724 missense probably benign 0.32
R7365:Myh4 UTSW 11 67242848 missense probably damaging 1.00
R7514:Myh4 UTSW 11 67243322 critical splice donor site probably null
R7553:Myh4 UTSW 11 67256395 missense probably damaging 0.99
R7666:Myh4 UTSW 11 67256281 missense probably damaging 0.99
R7673:Myh4 UTSW 11 67245513 missense probably damaging 1.00
R7685:Myh4 UTSW 11 67240930 missense probably benign 0.13
R8154:Myh4 UTSW 11 67253374 missense probably damaging 1.00
X0027:Myh4 UTSW 11 67246480 missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67248641 missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67253505 missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67256271 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAAGGCATCCGCATCTGTAGGAAG -3'
(R):5'- AGGCAGACACTCTTTGCTCCTCAC -3'

Sequencing Primer
(F):5'- TCTATGCAGACTTCAAGCAGAG -3'
(R):5'- ATGAGCTGAGCCAGCTTTTC -3'
Posted On2014-05-14