Mutagenetix > Incidental Mutation

Incidental Mutation 'R1716:Itga2b'

191041

Institutional Source

Beutler Lab

Gene Symbol

Itga2b

Ensembl Gene

ENSMUSG00000034664

Gene Name

integrin alpha 2b

Synonyms

platelet glycoprotein IIb, GpIIb, alphaIIb, GP IIb, CD41

MMRRC Submission

039749-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.191) question?

Stock #

R1716 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102453297-102470122 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 102460777 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 574 (I574S)

Ref Sequence

ENSEMBL: ENSMUSP00000099375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103086]

AlphaFold

Q9QUM0

Predicted Effect

probably benign
Transcript: ENSMUST00000103086
AA Change: I574S

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099375
Gene: ENSMUSG00000034664
AA Change: I574S

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Int_alpha	46	103	2.34e-10	SMART
Int_alpha	261	311	1.3e-3	SMART
Int_alpha	315	376	4.9e-13	SMART
Int_alpha	382	438	4.34e-14	SMART
Int_alpha	443	494	4.05e-5	SMART
low complexity region	552	567	N/A	INTRINSIC
SCOP:d1m1xa2	635	770	1e-48	SMART
SCOP:d1m1xa3	775	995	3e-66	SMART
Pfam:Integrin_alpha	1015	1029	5.7e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124767

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128752

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130433

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131247

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134735

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151625

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174900

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a bleeding disorder, lack platelet binding to fibrinogen, absence of fibrinogen in platelet alpha granules, and increased numbers of hematopoietic progenitors in yolk sac, fetal liver, and bone marrow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	G	7: 79,082,198	T2A	unknown	Het
Adgrf3	T	A	5: 30,197,551	Q493L	probably benign	Het
Ak6	T	C	13: 100,655,669	S207P	probably benign	Het
Ang	A	G	14: 51,101,480	D26G	probably benign	Het
Ang	T	C	14: 51,101,500	F33L	probably damaging	Het
Arhgef38	T	A	3: 133,140,837	Y389F	probably benign	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Bicd2	C	A	13: 49,378,310	H343N	probably benign	Het
Casp4	G	A	9: 5,308,919		probably null	Het
Cd22	A	G	7: 30,877,678	F68S	probably damaging	Het
Cd46	T	A	1: 195,077,809	Q245L	probably benign	Het
Cntnap2	A	T	6: 47,107,892	R1096*	probably null	Het
Cntnap3	A	G	13: 64,762,002	V763A	probably damaging	Het
Cyp3a11	T	C	5: 145,868,966	T171A	probably benign	Het
Defa30	A	G	8: 21,135,415	Y65C	probably damaging	Het
Defb18	A	T	1: 18,236,651	M27K	probably benign	Het
Dnah17	A	G	11: 118,032,598	S4071P	probably benign	Het
Dnah7b	T	A	1: 46,191,783	D1400E	probably damaging	Het
Dpysl5	C	T	5: 30,777,994	T147I	probably benign	Het
Dsg4	C	T	18: 20,462,461	R574*	probably null	Het
Epm2a	A	G	10: 11,448,836	E223G	probably benign	Het
Etl4	T	C	2: 20,743,681	S75P	probably damaging	Het
Fam189a1	A	T	7: 64,776,885		probably null	Het
Fbxw15	T	A	9: 109,557,136	M312L	probably benign	Het
Fcgr4	C	T	1: 171,020,103	T90I	probably damaging	Het
Fras1	T	A	5: 96,552,725	D201E	probably benign	Het
Gadl1	A	T	9: 116,006,508	K335*	probably null	Het
Gcsam	T	G	16: 45,619,993	V133G	probably damaging	Het
Gml	G	T	15: 74,813,816	L107I	possibly damaging	Het
Golga2	T	A	2: 32,302,897	L409Q	probably damaging	Het
Gtf2a1l	A	T	17: 88,694,580	Q241L	probably benign	Het
Gtf3c3	A	G	1: 54,399,260	Y799H	probably damaging	Het
Guca1b	T	G	17: 47,391,201		probably benign	Het
Igdcc4	C	A	9: 65,126,897	H617Q	probably damaging	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Kcnk7	A	T	19: 5,706,831	I283F	probably damaging	Het
Kirrel3	T	A	9: 35,023,547	L450M	probably damaging	Het
Lmntd1	A	T	6: 145,419,874	S176R	probably damaging	Het
Lrrc39	C	T	3: 116,579,567	T292I	probably benign	Het
Ltbp1	A	T	17: 75,315,024	H801L	probably benign	Het
Macf1	T	A	4: 123,401,403	Q3318L	probably damaging	Het
Man1b1	T	A	2: 25,345,020	N282K	probably benign	Het
Map2k6	A	T	11: 110,497,901	E223V	probably damaging	Het
Marf1	C	A	16: 14,142,586	R531S	possibly damaging	Het
Mfge8	G	A	7: 79,142,443	R245C	probably damaging	Het
Mgea5	C	A	19: 45,752,174	K907N	probably benign	Het
Mogat1	T	G	1: 78,538,044	N318K	probably benign	Het
Myh4	T	A	11: 67,250,309	S732R	possibly damaging	Het
Myt1l	T	A	12: 29,811,538	D106E	unknown	Het
Ndc1	T	C	4: 107,384,795	F302L	probably damaging	Het
Ndrg4	C	T	8: 95,712,328	A290V	probably benign	Het
Nfia	A	T	4: 98,063,128	K397N	probably damaging	Het
Nlrp4e	A	T	7: 23,321,033	Q315L	possibly damaging	Het
Olfr51	T	A	11: 51,007,852	N293K	probably damaging	Het
Olfr9	A	C	10: 128,990,852	*313C	probably null	Het
Peg3	T	C	7: 6,707,781	I1481V	possibly damaging	Het
Phldb2	C	T	16: 45,775,050	G883D	probably benign	Het
Pik3c2b	T	A	1: 133,094,826	Y1169N	probably damaging	Het
Plcl1	A	T	1: 55,695,838	I113F	probably damaging	Het
Pomt2	T	C	12: 87,124,836	I457V	probably benign	Het
Ppil1	T	C	17: 29,261,835	N38S	possibly damaging	Het
Prf1	A	G	10: 61,300,452	N169S	probably benign	Het
Prmt8	A	C	6: 127,726,523		probably null	Het
Ptprg	T	A	14: 12,154,360	S694T	probably benign	Het
Rab12	A	T	17: 66,500,320	M138K	possibly damaging	Het
Reln	T	C	5: 21,955,095	T2159A	probably damaging	Het
Retsat	A	T	6: 72,606,080	Y36F	probably damaging	Het
Rgs14	A	T	13: 55,378,883	Q116L	probably damaging	Het
Rlbp1	A	T	7: 79,375,936	N252K	probably damaging	Het
Rtraf	A	G	14: 19,812,174	L215P	probably damaging	Het
Sec1	A	T	7: 45,679,365	M86K	probably benign	Het
Sec24b	A	T	3: 130,041,016	S42T	possibly damaging	Het
Serpinb9d	T	C	13: 33,196,517	S129P	probably damaging	Het
Slc35f5	T	G	1: 125,584,532	D356E	possibly damaging	Het
Smpd4	T	C	16: 17,642,501	S694P	probably damaging	Het
Spag6	G	T	2: 18,745,609		probably null	Het
Spata31d1c	T	C	13: 65,033,216	I43T	possibly damaging	Het
Ssh1	T	C	5: 113,952,020	D314G	possibly damaging	Het
Tnfrsf17	G	A	16: 11,319,731	D111N	probably benign	Het
Ttn	A	G	2: 76,723,291	I30994T	probably damaging	Het
Ttn	A	T	2: 76,783,976	F8737L	probably damaging	Het
Ush1c	G	T	7: 46,195,728	F890L	probably benign	Het
Usp36	C	T	11: 118,272,131		probably null	Het
Vmn2r115	T	C	17: 23,347,821	Y436H	probably benign	Het
Vmn2r94	T	A	17: 18,257,373	M259L	probably benign	Het
Wwp1	T	C	4: 19,659,698	T197A	probably benign	Het
Zbtb37	T	A	1: 161,020,244	M398L	probably benign	Het
Zfp804b	C	T	5: 6,769,673	C1130Y	probably benign	Het
Zfp9	A	G	6: 118,464,751	C317R	probably damaging	Het
Zscan20	T	C	4: 128,586,541	H719R	probably damaging	Het

Other mutations in Itga2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Itga2b	APN	11	102455583	missense	probably damaging	1.00
IGL02197:Itga2b	APN	11	102466319	missense	probably benign	0.19
IGL02349:Itga2b	APN	11	102461363	missense	probably damaging	0.98
IGL02711:Itga2b	APN	11	102465725	missense	possibly damaging	0.53
R0282:Itga2b	UTSW	11	102460846	missense	probably damaging	0.99
R0349:Itga2b	UTSW	11	102467426	missense	probably damaging	0.98
R0384:Itga2b	UTSW	11	102465362	splice site	probably null
R0403:Itga2b	UTSW	11	102467326	critical splice donor site	probably null
R0452:Itga2b	UTSW	11	102465953	splice site	probably null
R0535:Itga2b	UTSW	11	102457533	missense	possibly damaging	0.65
R1412:Itga2b	UTSW	11	102457005	missense	probably benign	0.00
R1517:Itga2b	UTSW	11	102466325	nonsense	probably null
R1615:Itga2b	UTSW	11	102460137	critical splice donor site	probably null
R1953:Itga2b	UTSW	11	102458183	missense	probably benign	0.18
R2001:Itga2b	UTSW	11	102467339	missense	probably benign
R2216:Itga2b	UTSW	11	102467866	missense	probably benign	0.35
R4193:Itga2b	UTSW	11	102469685	missense	probably benign	0.01
R4770:Itga2b	UTSW	11	102460756	missense	probably damaging	1.00
R4805:Itga2b	UTSW	11	102467866	missense	probably benign	0.00
R4880:Itga2b	UTSW	11	102457722	intron	probably benign
R4906:Itga2b	UTSW	11	102461159	missense	probably benign	0.43
R5112:Itga2b	UTSW	11	102458191	missense	probably damaging	0.99
R5362:Itga2b	UTSW	11	102461135	missense	probably damaging	0.99
R5739:Itga2b	UTSW	11	102465909	missense	probably benign	0.14
R5761:Itga2b	UTSW	11	102466274	missense	probably benign	0.00
R5840:Itga2b	UTSW	11	102461331	missense	probably damaging	1.00
R5851:Itga2b	UTSW	11	102457601	intron	probably benign
R6239:Itga2b	UTSW	11	102465318	missense	possibly damaging	0.61
R6491:Itga2b	UTSW	11	102459869	splice site	probably null
R7426:Itga2b	UTSW	11	102456294	missense	probably benign	0.01
R7635:Itga2b	UTSW	11	102461756	missense	probably damaging	1.00
R7664:Itga2b	UTSW	11	102460840	missense	probably damaging	1.00
R7832:Itga2b	UTSW	11	102457282	missense	probably damaging	0.98
R8120:Itga2b	UTSW	11	102469542	missense	probably damaging	0.98
R8254:Itga2b	UTSW	11	102467386	missense	probably benign	0.16
R8296:Itga2b	UTSW	11	102461159	missense	possibly damaging	0.79
R8362:Itga2b	UTSW	11	102461363	missense	probably damaging	1.00
R8815:Itga2b	UTSW	11	102460861	missense	possibly damaging	0.91
R8901:Itga2b	UTSW	11	102460804	missense	probably damaging	0.99
R8985:Itga2b	UTSW	11	102465462	intron	probably benign
R9277:Itga2b	UTSW	11	102461156	missense	probably damaging	1.00
R9335:Itga2b	UTSW	11	102455652	missense	probably damaging	0.99
R9496:Itga2b	UTSW	11	102467803	missense	probably damaging	1.00
Z1177:Itga2b	UTSW	11	102467076	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTCCATGCAATACCACGGCAG -3'
(R):5'- TGGGAGCCACAGGACACAACATTC -3'

Sequencing Primer
(F):5'- ACACGTTGAGGCTTAGCAC -3'
(R):5'- CTCAGAAGCTGCGTGAGTG -3'

Posted On

2014-05-14