Incidental Mutation 'R1716:Map2k6'
ID191043
Institutional Source Beutler Lab
Gene Symbol Map2k6
Ensembl Gene ENSMUSG00000020623
Gene Namemitogen-activated protein kinase kinase 6
SynonymsMAP kinase kinase 6, SAPKK3, Prkmk6, MKK6
MMRRC Submission 039749-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1716 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110399122-110525522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110497901 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 223 (E223V)
Ref Sequence ENSEMBL: ENSMUSP00000020949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020949] [ENSMUST00000100260]
Predicted Effect probably damaging
Transcript: ENSMUST00000020949
AA Change: E223V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020949
Gene: ENSMUSG00000020623
AA Change: E223V

DomainStartEndE-ValueType
S_TKc 53 314 2.82e-73 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100260
AA Change: E223V

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097831
Gene: ENSMUSG00000020623
AA Change: E223V

DomainStartEndE-ValueType
Pfam:Pkinase 53 288 4.3e-47 PFAM
Pfam:Pkinase_Tyr 53 289 1.2e-32 PFAM
Pfam:Kinase-like 57 274 7.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146540
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dual specificity protein kinase family, which functions as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein phosphorylates and activates p38 MAP kinase in response to inflammatory cytokines or environmental stress. As an essential component of p38 MAP kinase mediated signal transduction pathway, this gene is involved in many cellular processes such as stress induced cell cycle arrest, transcription activation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null targeted mutations of this gene are viable, grow normally and have no gross physical or histologic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,082,198 T2A unknown Het
Adgrf3 T A 5: 30,197,551 Q493L probably benign Het
Ak6 T C 13: 100,655,669 S207P probably benign Het
Ang A G 14: 51,101,480 D26G probably benign Het
Ang T C 14: 51,101,500 F33L probably damaging Het
Arhgef38 T A 3: 133,140,837 Y389F probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bicd2 C A 13: 49,378,310 H343N probably benign Het
Casp4 G A 9: 5,308,919 probably null Het
Cd22 A G 7: 30,877,678 F68S probably damaging Het
Cd46 T A 1: 195,077,809 Q245L probably benign Het
Cntnap2 A T 6: 47,107,892 R1096* probably null Het
Cntnap3 A G 13: 64,762,002 V763A probably damaging Het
Cyp3a11 T C 5: 145,868,966 T171A probably benign Het
Defa30 A G 8: 21,135,415 Y65C probably damaging Het
Defb18 A T 1: 18,236,651 M27K probably benign Het
Dnah17 A G 11: 118,032,598 S4071P probably benign Het
Dnah7b T A 1: 46,191,783 D1400E probably damaging Het
Dpysl5 C T 5: 30,777,994 T147I probably benign Het
Dsg4 C T 18: 20,462,461 R574* probably null Het
Epm2a A G 10: 11,448,836 E223G probably benign Het
Etl4 T C 2: 20,743,681 S75P probably damaging Het
Fam189a1 A T 7: 64,776,885 probably null Het
Fbxw15 T A 9: 109,557,136 M312L probably benign Het
Fcgr4 C T 1: 171,020,103 T90I probably damaging Het
Fras1 T A 5: 96,552,725 D201E probably benign Het
Gadl1 A T 9: 116,006,508 K335* probably null Het
Gcsam T G 16: 45,619,993 V133G probably damaging Het
Gml G T 15: 74,813,816 L107I possibly damaging Het
Golga2 T A 2: 32,302,897 L409Q probably damaging Het
Gtf2a1l A T 17: 88,694,580 Q241L probably benign Het
Gtf3c3 A G 1: 54,399,260 Y799H probably damaging Het
Guca1b T G 17: 47,391,201 probably benign Het
Igdcc4 C A 9: 65,126,897 H617Q probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itga2b A C 11: 102,460,777 I574S probably benign Het
Kcnk7 A T 19: 5,706,831 I283F probably damaging Het
Kirrel3 T A 9: 35,023,547 L450M probably damaging Het
Lmntd1 A T 6: 145,419,874 S176R probably damaging Het
Lrrc39 C T 3: 116,579,567 T292I probably benign Het
Ltbp1 A T 17: 75,315,024 H801L probably benign Het
Macf1 T A 4: 123,401,403 Q3318L probably damaging Het
Man1b1 T A 2: 25,345,020 N282K probably benign Het
Marf1 C A 16: 14,142,586 R531S possibly damaging Het
Mfge8 G A 7: 79,142,443 R245C probably damaging Het
Mgea5 C A 19: 45,752,174 K907N probably benign Het
Mogat1 T G 1: 78,538,044 N318K probably benign Het
Myh4 T A 11: 67,250,309 S732R possibly damaging Het
Myt1l T A 12: 29,811,538 D106E unknown Het
Ndc1 T C 4: 107,384,795 F302L probably damaging Het
Ndrg4 C T 8: 95,712,328 A290V probably benign Het
Nfia A T 4: 98,063,128 K397N probably damaging Het
Nlrp4e A T 7: 23,321,033 Q315L possibly damaging Het
Olfr51 T A 11: 51,007,852 N293K probably damaging Het
Olfr9 A C 10: 128,990,852 *313C probably null Het
Peg3 T C 7: 6,707,781 I1481V possibly damaging Het
Phldb2 C T 16: 45,775,050 G883D probably benign Het
Pik3c2b T A 1: 133,094,826 Y1169N probably damaging Het
Plcl1 A T 1: 55,695,838 I113F probably damaging Het
Pomt2 T C 12: 87,124,836 I457V probably benign Het
Ppil1 T C 17: 29,261,835 N38S possibly damaging Het
Prf1 A G 10: 61,300,452 N169S probably benign Het
Prmt8 A C 6: 127,726,523 probably null Het
Ptprg T A 14: 12,154,360 S694T probably benign Het
Rab12 A T 17: 66,500,320 M138K possibly damaging Het
Reln T C 5: 21,955,095 T2159A probably damaging Het
Retsat A T 6: 72,606,080 Y36F probably damaging Het
Rgs14 A T 13: 55,378,883 Q116L probably damaging Het
Rlbp1 A T 7: 79,375,936 N252K probably damaging Het
Rtraf A G 14: 19,812,174 L215P probably damaging Het
Sec1 A T 7: 45,679,365 M86K probably benign Het
Sec24b A T 3: 130,041,016 S42T possibly damaging Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc35f5 T G 1: 125,584,532 D356E possibly damaging Het
Smpd4 T C 16: 17,642,501 S694P probably damaging Het
Spag6 G T 2: 18,745,609 probably null Het
Spata31d1c T C 13: 65,033,216 I43T possibly damaging Het
Ssh1 T C 5: 113,952,020 D314G possibly damaging Het
Tnfrsf17 G A 16: 11,319,731 D111N probably benign Het
Ttn A G 2: 76,723,291 I30994T probably damaging Het
Ttn A T 2: 76,783,976 F8737L probably damaging Het
Ush1c G T 7: 46,195,728 F890L probably benign Het
Usp36 C T 11: 118,272,131 probably null Het
Vmn2r115 T C 17: 23,347,821 Y436H probably benign Het
Vmn2r94 T A 17: 18,257,373 M259L probably benign Het
Wwp1 T C 4: 19,659,698 T197A probably benign Het
Zbtb37 T A 1: 161,020,244 M398L probably benign Het
Zfp804b C T 5: 6,769,673 C1130Y probably benign Het
Zfp9 A G 6: 118,464,751 C317R probably damaging Het
Zscan20 T C 4: 128,586,541 H719R probably damaging Het
Other mutations in Map2k6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Map2k6 APN 11 110496411 missense probably damaging 1.00
IGL01778:Map2k6 APN 11 110512869 intron probably benign
IGL02058:Map2k6 APN 11 110492583 missense probably damaging 1.00
IGL02580:Map2k6 APN 11 110490841 missense probably damaging 0.98
IGL03139:Map2k6 APN 11 110496473 splice site probably benign
Heartening UTSW 11 110492908 missense
Uplifting UTSW 11 110492562 missense probably damaging 1.00
R0230:Map2k6 UTSW 11 110496455 missense probably damaging 1.00
R0361:Map2k6 UTSW 11 110499509 missense probably damaging 0.99
R0634:Map2k6 UTSW 11 110494343 nonsense probably null
R2214:Map2k6 UTSW 11 110496341 missense probably damaging 1.00
R2279:Map2k6 UTSW 11 110499464 missense probably damaging 1.00
R4610:Map2k6 UTSW 11 110499474 missense probably damaging 1.00
R4677:Map2k6 UTSW 11 110399394 utr 5 prime probably benign
R5299:Map2k6 UTSW 11 110492963 missense probably benign 0.03
R5761:Map2k6 UTSW 11 110399371 utr 5 prime probably benign
R5996:Map2k6 UTSW 11 110497906 missense possibly damaging 0.77
R6391:Map2k6 UTSW 11 110490877 critical splice donor site probably null
R6529:Map2k6 UTSW 11 110492562 missense probably damaging 1.00
R7020:Map2k6 UTSW 11 110506714 intron probably benign
R7345:Map2k6 UTSW 11 110492908 missense
R7681:Map2k6 UTSW 11 110497903 nonsense probably null
R7980:Map2k6 UTSW 11 110499384 missense
R8087:Map2k6 UTSW 11 110490176 missense probably benign 0.00
R8093:Map2k6 UTSW 11 110482585 missense probably benign
R8531:Map2k6 UTSW 11 110399349 start gained probably benign
R8834:Map2k6 UTSW 11 110492593 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCCATGTTTGAGTAAAATCCCCG -3'
(R):5'- GCCCTGGAAAATAACCTGCCATCTC -3'

Sequencing Primer
(F):5'- GGTCTCTTAACATCAGACGGTAGC -3'
(R):5'- CCTGCCATCTCAGAGAGAAAGG -3'
Posted On2014-05-14