Incidental Mutation 'R1716:Usp36'
ID191045
Institutional Source Beutler Lab
Gene Symbol Usp36
Ensembl Gene ENSMUSG00000033909
Gene Nameubiquitin specific peptidase 36
Synonyms2700002L06Rik
MMRRC Submission 039749-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R1716 (G1)
Quality Score122
Status Not validated
Chromosome11
Chromosomal Location118259651-118290244 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 118272131 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]
Predicted Effect probably null
Transcript: ENSMUST00000092382
SMART Domains Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.6e-55 PFAM
Pfam:UCH_1 122 402 3.6e-26 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106296
SMART Domains Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.1e-49 PFAM
Pfam:UCH_1 122 402 2.2e-23 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000144153
SMART Domains Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909

DomainStartEndE-ValueType
Pfam:UCH 1 255 1e-40 PFAM
Pfam:UCH_1 4 237 2.9e-17 PFAM
low complexity region 375 393 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 768 778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,082,198 T2A unknown Het
Adgrf3 T A 5: 30,197,551 Q493L probably benign Het
Ak6 T C 13: 100,655,669 S207P probably benign Het
Ang A G 14: 51,101,480 D26G probably benign Het
Ang T C 14: 51,101,500 F33L probably damaging Het
Arhgef38 T A 3: 133,140,837 Y389F probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bicd2 C A 13: 49,378,310 H343N probably benign Het
Casp4 G A 9: 5,308,919 probably null Het
Cd22 A G 7: 30,877,678 F68S probably damaging Het
Cd46 T A 1: 195,077,809 Q245L probably benign Het
Cntnap2 A T 6: 47,107,892 R1096* probably null Het
Cntnap3 A G 13: 64,762,002 V763A probably damaging Het
Cyp3a11 T C 5: 145,868,966 T171A probably benign Het
Defa30 A G 8: 21,135,415 Y65C probably damaging Het
Defb18 A T 1: 18,236,651 M27K probably benign Het
Dnah17 A G 11: 118,032,598 S4071P probably benign Het
Dnah7b T A 1: 46,191,783 D1400E probably damaging Het
Dpysl5 C T 5: 30,777,994 T147I probably benign Het
Dsg4 C T 18: 20,462,461 R574* probably null Het
Epm2a A G 10: 11,448,836 E223G probably benign Het
Etl4 T C 2: 20,743,681 S75P probably damaging Het
Fam189a1 A T 7: 64,776,885 probably null Het
Fbxw15 T A 9: 109,557,136 M312L probably benign Het
Fcgr4 C T 1: 171,020,103 T90I probably damaging Het
Fras1 T A 5: 96,552,725 D201E probably benign Het
Gadl1 A T 9: 116,006,508 K335* probably null Het
Gcsam T G 16: 45,619,993 V133G probably damaging Het
Gml G T 15: 74,813,816 L107I possibly damaging Het
Golga2 T A 2: 32,302,897 L409Q probably damaging Het
Gtf2a1l A T 17: 88,694,580 Q241L probably benign Het
Gtf3c3 A G 1: 54,399,260 Y799H probably damaging Het
Guca1b T G 17: 47,391,201 probably benign Het
Igdcc4 C A 9: 65,126,897 H617Q probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itga2b A C 11: 102,460,777 I574S probably benign Het
Kcnk7 A T 19: 5,706,831 I283F probably damaging Het
Kirrel3 T A 9: 35,023,547 L450M probably damaging Het
Lmntd1 A T 6: 145,419,874 S176R probably damaging Het
Lrrc39 C T 3: 116,579,567 T292I probably benign Het
Ltbp1 A T 17: 75,315,024 H801L probably benign Het
Macf1 T A 4: 123,401,403 Q3318L probably damaging Het
Man1b1 T A 2: 25,345,020 N282K probably benign Het
Map2k6 A T 11: 110,497,901 E223V probably damaging Het
Marf1 C A 16: 14,142,586 R531S possibly damaging Het
Mfge8 G A 7: 79,142,443 R245C probably damaging Het
Mgea5 C A 19: 45,752,174 K907N probably benign Het
Mogat1 T G 1: 78,538,044 N318K probably benign Het
Myh4 T A 11: 67,250,309 S732R possibly damaging Het
Myt1l T A 12: 29,811,538 D106E unknown Het
Ndc1 T C 4: 107,384,795 F302L probably damaging Het
Ndrg4 C T 8: 95,712,328 A290V probably benign Het
Nfia A T 4: 98,063,128 K397N probably damaging Het
Nlrp4e A T 7: 23,321,033 Q315L possibly damaging Het
Olfr51 T A 11: 51,007,852 N293K probably damaging Het
Olfr9 A C 10: 128,990,852 *313C probably null Het
Peg3 T C 7: 6,707,781 I1481V possibly damaging Het
Phldb2 C T 16: 45,775,050 G883D probably benign Het
Pik3c2b T A 1: 133,094,826 Y1169N probably damaging Het
Plcl1 A T 1: 55,695,838 I113F probably damaging Het
Pomt2 T C 12: 87,124,836 I457V probably benign Het
Ppil1 T C 17: 29,261,835 N38S possibly damaging Het
Prf1 A G 10: 61,300,452 N169S probably benign Het
Prmt8 A C 6: 127,726,523 probably null Het
Ptprg T A 14: 12,154,360 S694T probably benign Het
Rab12 A T 17: 66,500,320 M138K possibly damaging Het
Reln T C 5: 21,955,095 T2159A probably damaging Het
Retsat A T 6: 72,606,080 Y36F probably damaging Het
Rgs14 A T 13: 55,378,883 Q116L probably damaging Het
Rlbp1 A T 7: 79,375,936 N252K probably damaging Het
Rtraf A G 14: 19,812,174 L215P probably damaging Het
Sec1 A T 7: 45,679,365 M86K probably benign Het
Sec24b A T 3: 130,041,016 S42T possibly damaging Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc35f5 T G 1: 125,584,532 D356E possibly damaging Het
Smpd4 T C 16: 17,642,501 S694P probably damaging Het
Spag6 G T 2: 18,745,609 probably null Het
Spata31d1c T C 13: 65,033,216 I43T possibly damaging Het
Ssh1 T C 5: 113,952,020 D314G possibly damaging Het
Tnfrsf17 G A 16: 11,319,731 D111N probably benign Het
Ttn A G 2: 76,723,291 I30994T probably damaging Het
Ttn A T 2: 76,783,976 F8737L probably damaging Het
Ush1c G T 7: 46,195,728 F890L probably benign Het
Vmn2r115 T C 17: 23,347,821 Y436H probably benign Het
Vmn2r94 T A 17: 18,257,373 M259L probably benign Het
Wwp1 T C 4: 19,659,698 T197A probably benign Het
Zbtb37 T A 1: 161,020,244 M398L probably benign Het
Zfp804b C T 5: 6,769,673 C1130Y probably benign Het
Zfp9 A G 6: 118,464,751 C317R probably damaging Het
Zscan20 T C 4: 128,586,541 H719R probably damaging Het
Other mutations in Usp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Usp36 APN 11 118264820 missense possibly damaging 0.76
IGL01115:Usp36 APN 11 118285960 missense probably damaging 1.00
IGL01720:Usp36 APN 11 118275002 missense probably damaging 0.99
IGL02410:Usp36 APN 11 118276185 missense probably damaging 1.00
IGL02700:Usp36 APN 11 118276157 missense possibly damaging 0.95
IGL02926:Usp36 APN 11 118264783 missense probably benign 0.22
IGL03145:Usp36 APN 11 118279241 missense probably damaging 1.00
IGL03203:Usp36 APN 11 118285810 missense probably benign 0.42
IGL03265:Usp36 APN 11 118264809 missense possibly damaging 0.65
R0482:Usp36 UTSW 11 118265194 missense probably benign 0.21
R0499:Usp36 UTSW 11 118273571 missense probably damaging 0.98
R0606:Usp36 UTSW 11 118263028 splice site probably benign
R0646:Usp36 UTSW 11 118273021 missense probably damaging 1.00
R1579:Usp36 UTSW 11 118284945 missense probably damaging 1.00
R1646:Usp36 UTSW 11 118273566 missense probably damaging 1.00
R1886:Usp36 UTSW 11 118272958 missense probably damaging 1.00
R2014:Usp36 UTSW 11 118262508 splice site probably benign
R2068:Usp36 UTSW 11 118275018 missense possibly damaging 0.80
R2146:Usp36 UTSW 11 118268665 missense probably benign 0.02
R2191:Usp36 UTSW 11 118285023 missense possibly damaging 0.95
R2899:Usp36 UTSW 11 118276756 splice site probably benign
R3176:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3177:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3276:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3277:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3615:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3616:Usp36 UTSW 11 118276759 critical splice donor site probably null
R3768:Usp36 UTSW 11 118263052 missense probably damaging 1.00
R3899:Usp36 UTSW 11 118279824 missense possibly damaging 0.90
R3900:Usp36 UTSW 11 118279824 missense possibly damaging 0.90
R4484:Usp36 UTSW 11 118285795 missense probably damaging 0.99
R4809:Usp36 UTSW 11 118263070 missense probably damaging 1.00
R5135:Usp36 UTSW 11 118264905 missense possibly damaging 0.58
R5323:Usp36 UTSW 11 118265194 missense probably benign 0.21
R6226:Usp36 UTSW 11 118277274 missense probably damaging 1.00
R6266:Usp36 UTSW 11 118268585 missense probably damaging 1.00
R7191:Usp36 UTSW 11 118268834 missense probably benign 0.39
R7215:Usp36 UTSW 11 118265154 missense possibly damaging 0.87
R7289:Usp36 UTSW 11 118273529 missense probably damaging 1.00
R7535:Usp36 UTSW 11 118262046 missense possibly damaging 0.92
R7675:Usp36 UTSW 11 118263696 missense probably benign 0.11
R7843:Usp36 UTSW 11 118285965 missense probably damaging 1.00
R8228:Usp36 UTSW 11 118264890 missense possibly damaging 0.77
X0020:Usp36 UTSW 11 118273613 missense probably damaging 1.00
Z1177:Usp36 UTSW 11 118276200 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAGTGGGATGTTTTCCCGATAG -3'
(R):5'- TTCCAGTGTCTCTGAGCCTGAGTG -3'

Sequencing Primer
(F):5'- ATAGCCTGTGTTCAGAAGCTGAC -3'
(R):5'- GTGGAGAAAATCTCTGACTCCTGTC -3'
Posted On2014-05-14