Incidental Mutation 'R1716:Cntnap3'
ID 191053
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Name contactin associated protein-like 3
Synonyms
MMRRC Submission 039749-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R1716 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 64883996-65051769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64909816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 763 (V763A)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
AlphaFold E9PY62
Predicted Effect probably damaging
Transcript: ENSMUST00000091554
AA Change: V763A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: V763A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222618
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 78,731,946 (GRCm39) T2A unknown Het
Adgrf3 T A 5: 30,402,549 (GRCm39) Q493L probably benign Het
Ak6 T C 13: 100,792,177 (GRCm39) S207P probably benign Het
Ang A G 14: 51,338,937 (GRCm39) D26G probably benign Het
Ang T C 14: 51,338,957 (GRCm39) F33L probably damaging Het
Arhgef38 T A 3: 132,846,598 (GRCm39) Y389F probably benign Het
Arhgef7 C A 8: 11,858,713 (GRCm39) probably null Het
Bicd2 C A 13: 49,531,786 (GRCm39) H343N probably benign Het
Casp4 G A 9: 5,308,919 (GRCm39) probably null Het
Cd22 A G 7: 30,577,103 (GRCm39) F68S probably damaging Het
Cd46 T A 1: 194,760,117 (GRCm39) Q245L probably benign Het
Cntnap2 A T 6: 47,084,826 (GRCm39) R1096* probably null Het
Cyp3a11 T C 5: 145,805,776 (GRCm39) T171A probably benign Het
Defa30 A G 8: 21,625,431 (GRCm39) Y65C probably damaging Het
Defb18 A T 1: 18,306,875 (GRCm39) M27K probably benign Het
Dnah17 A G 11: 117,923,424 (GRCm39) S4071P probably benign Het
Dnah7b T A 1: 46,230,943 (GRCm39) D1400E probably damaging Het
Dpysl5 C T 5: 30,935,338 (GRCm39) T147I probably benign Het
Dsg4 C T 18: 20,595,518 (GRCm39) R574* probably null Het
Entrep2 A T 7: 64,426,633 (GRCm39) probably null Het
Epm2a A G 10: 11,324,580 (GRCm39) E223G probably benign Het
Etl4 T C 2: 20,748,492 (GRCm39) S75P probably damaging Het
Fbxw15 T A 9: 109,386,204 (GRCm39) M312L probably benign Het
Fcgr4 C T 1: 170,847,672 (GRCm39) T90I probably damaging Het
Fras1 T A 5: 96,700,584 (GRCm39) D201E probably benign Het
Gadl1 A T 9: 115,835,576 (GRCm39) K335* probably null Het
Gcsam T G 16: 45,440,356 (GRCm39) V133G probably damaging Het
Gml G T 15: 74,685,665 (GRCm39) L107I possibly damaging Het
Golga2 T A 2: 32,192,909 (GRCm39) L409Q probably damaging Het
Gtf2a1l A T 17: 89,002,008 (GRCm39) Q241L probably benign Het
Gtf3c3 A G 1: 54,438,419 (GRCm39) Y799H probably damaging Het
Guca1b T G 17: 47,702,126 (GRCm39) probably benign Het
Igdcc4 C A 9: 65,034,179 (GRCm39) H617Q probably damaging Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Itga2b A C 11: 102,351,603 (GRCm39) I574S probably benign Het
Kcnk7 A T 19: 5,756,859 (GRCm39) I283F probably damaging Het
Kirrel3 T A 9: 34,934,843 (GRCm39) L450M probably damaging Het
Lmntd1 A T 6: 145,365,600 (GRCm39) S176R probably damaging Het
Lrrc39 C T 3: 116,373,216 (GRCm39) T292I probably benign Het
Ltbp1 A T 17: 75,622,019 (GRCm39) H801L probably benign Het
Macf1 T A 4: 123,295,196 (GRCm39) Q3318L probably damaging Het
Man1b1 T A 2: 25,235,032 (GRCm39) N282K probably benign Het
Map2k6 A T 11: 110,388,727 (GRCm39) E223V probably damaging Het
Marf1 C A 16: 13,960,450 (GRCm39) R531S possibly damaging Het
Mfge8 G A 7: 78,792,191 (GRCm39) R245C probably damaging Het
Mogat1 T G 1: 78,514,681 (GRCm39) N318K probably benign Het
Myh4 T A 11: 67,141,135 (GRCm39) S732R possibly damaging Het
Myt1l T A 12: 29,861,537 (GRCm39) D106E unknown Het
Ndc1 T C 4: 107,241,992 (GRCm39) F302L probably damaging Het
Ndrg4 C T 8: 96,438,956 (GRCm39) A290V probably benign Het
Nfia A T 4: 97,951,365 (GRCm39) K397N probably damaging Het
Nlrp4e A T 7: 23,020,458 (GRCm39) Q315L possibly damaging Het
Oga C A 19: 45,740,613 (GRCm39) K907N probably benign Het
Or10p22 A C 10: 128,826,721 (GRCm39) *313C probably null Het
Or1ad8 T A 11: 50,898,679 (GRCm39) N293K probably damaging Het
Peg3 T C 7: 6,710,780 (GRCm39) I1481V possibly damaging Het
Phldb2 C T 16: 45,595,413 (GRCm39) G883D probably benign Het
Pik3c2b T A 1: 133,022,564 (GRCm39) Y1169N probably damaging Het
Plcl1 A T 1: 55,734,997 (GRCm39) I113F probably damaging Het
Pomt2 T C 12: 87,171,610 (GRCm39) I457V probably benign Het
Ppil1 T C 17: 29,480,809 (GRCm39) N38S possibly damaging Het
Prf1 A G 10: 61,136,231 (GRCm39) N169S probably benign Het
Prmt8 A C 6: 127,703,486 (GRCm39) probably null Het
Ptprg T A 14: 12,154,360 (GRCm38) S694T probably benign Het
Rab12 A T 17: 66,807,315 (GRCm39) M138K possibly damaging Het
Reln T C 5: 22,160,093 (GRCm39) T2159A probably damaging Het
Retsat A T 6: 72,583,063 (GRCm39) Y36F probably damaging Het
Rgs14 A T 13: 55,526,696 (GRCm39) Q116L probably damaging Het
Rlbp1 A T 7: 79,025,684 (GRCm39) N252K probably damaging Het
Rtraf A G 14: 19,862,242 (GRCm39) L215P probably damaging Het
Sec1 A T 7: 45,328,789 (GRCm39) M86K probably benign Het
Sec24b A T 3: 129,834,665 (GRCm39) S42T possibly damaging Het
Serpinb9d T C 13: 33,380,500 (GRCm39) S129P probably damaging Het
Slc35f5 T G 1: 125,512,269 (GRCm39) D356E possibly damaging Het
Smpd4 T C 16: 17,460,365 (GRCm39) S694P probably damaging Het
Spag6 G T 2: 18,750,420 (GRCm39) probably null Het
Spata31d1c T C 13: 65,181,030 (GRCm39) I43T possibly damaging Het
Ssh1 T C 5: 114,090,081 (GRCm39) D314G possibly damaging Het
Tnfrsf17 G A 16: 11,137,595 (GRCm39) D111N probably benign Het
Ttn A G 2: 76,553,635 (GRCm39) I30994T probably damaging Het
Ttn A T 2: 76,614,320 (GRCm39) F8737L probably damaging Het
Ush1c G T 7: 45,845,152 (GRCm39) F890L probably benign Het
Usp36 C T 11: 118,162,957 (GRCm39) probably null Het
Vmn2r115 T C 17: 23,566,795 (GRCm39) Y436H probably benign Het
Vmn2r94 T A 17: 18,477,635 (GRCm39) M259L probably benign Het
Wwp1 T C 4: 19,659,698 (GRCm39) T197A probably benign Het
Zbtb37 T A 1: 160,847,814 (GRCm39) M398L probably benign Het
Zfp804b C T 5: 6,819,673 (GRCm39) C1130Y probably benign Het
Zfp9 A G 6: 118,441,712 (GRCm39) C317R probably damaging Het
Zscan20 T C 4: 128,480,334 (GRCm39) H719R probably damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64,920,545 (GRCm39) missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64,893,619 (GRCm39) splice site probably benign
IGL00976:Cntnap3 APN 13 64,942,166 (GRCm39) missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64,935,651 (GRCm39) missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64,905,115 (GRCm39) missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64,946,922 (GRCm39) missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64,946,878 (GRCm39) splice site probably benign
IGL02133:Cntnap3 APN 13 64,899,487 (GRCm39) splice site probably benign
IGL02251:Cntnap3 APN 13 64,909,850 (GRCm39) missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64,905,225 (GRCm39) missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64,899,565 (GRCm39) missense probably benign
IGL02456:Cntnap3 APN 13 64,946,872 (GRCm39) splice site probably benign
IGL02589:Cntnap3 APN 13 64,940,244 (GRCm39) missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64,919,946 (GRCm39) missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64,905,223 (GRCm39) missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64,888,839 (GRCm39) missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64,929,559 (GRCm39) missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 65,035,582 (GRCm39) nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64,905,024 (GRCm39) missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64,905,250 (GRCm39) splice site probably benign
R0422:Cntnap3 UTSW 13 64,905,099 (GRCm39) missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64,926,690 (GRCm39) missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64,909,859 (GRCm39) missense probably benign 0.01
R0499:Cntnap3 UTSW 13 65,006,492 (GRCm39) missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64,909,814 (GRCm39) missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64,906,228 (GRCm39) missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64,905,211 (GRCm39) missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64,935,724 (GRCm39) missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64,906,104 (GRCm39) missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64,888,626 (GRCm39) critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64,888,406 (GRCm39) missense probably benign 0.17
R1905:Cntnap3 UTSW 13 65,051,578 (GRCm39) missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64,906,204 (GRCm39) missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64,942,076 (GRCm39) missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64,888,813 (GRCm39) missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64,896,274 (GRCm39) missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64,926,667 (GRCm39) missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64,926,697 (GRCm39) missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64,926,602 (GRCm39) critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64,926,676 (GRCm39) missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64,935,520 (GRCm39) missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64,909,798 (GRCm39) missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64,942,162 (GRCm39) missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64,909,824 (GRCm39) missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64,909,792 (GRCm39) missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 65,051,572 (GRCm39) missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64,894,552 (GRCm39) missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64,935,769 (GRCm39) missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64,896,391 (GRCm39) missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64,946,994 (GRCm39) missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64,935,583 (GRCm39) missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64,929,702 (GRCm39) missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64,896,373 (GRCm39) missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64,929,539 (GRCm39) critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64,919,776 (GRCm39) missense probably benign
R7425:Cntnap3 UTSW 13 64,906,066 (GRCm39) missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64,919,815 (GRCm39) missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64,920,591 (GRCm39) nonsense probably null
R7810:Cntnap3 UTSW 13 64,941,122 (GRCm39) missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 65,051,587 (GRCm39) missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64,935,681 (GRCm39) missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64,886,479 (GRCm39) missense probably benign 0.31
R8491:Cntnap3 UTSW 13 64,933,157 (GRCm39) missense probably damaging 1.00
R9086:Cntnap3 UTSW 13 64,929,573 (GRCm39) missense probably damaging 1.00
R9087:Cntnap3 UTSW 13 64,899,532 (GRCm39) missense probably damaging 0.96
R9398:Cntnap3 UTSW 13 65,051,648 (GRCm39) missense probably benign 0.41
R9475:Cntnap3 UTSW 13 64,946,949 (GRCm39) missense probably damaging 1.00
R9625:Cntnap3 UTSW 13 65,006,579 (GRCm39) missense probably damaging 1.00
R9679:Cntnap3 UTSW 13 64,899,562 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap3 UTSW 13 64,940,202 (GRCm39) missense probably damaging 0.98
Z1176:Cntnap3 UTSW 13 64,888,686 (GRCm39) frame shift probably null
Z1177:Cntnap3 UTSW 13 64,929,706 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCTGGCCCTAAGATTGCCTCTAC -3'
(R):5'- TACCTGGCACAGCACCTGGTCAAC -3'

Sequencing Primer
(F):5'- AAGATTGCCTCTACTTTTGTGAC -3'
(R):5'- CAGCACCTGGTCAACAGGAG -3'
Posted On 2014-05-14