Incidental Mutation 'R1716:Dsg4'
ID191078
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Namedesmoglein 4
Synonymslah, CDHF13
MMRRC Submission 039749-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R1716 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20436175-20471821 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 20462461 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 574 (R574*)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
Predicted Effect probably null
Transcript: ENSMUST00000019426
AA Change: R574*
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: R574*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,082,198 T2A unknown Het
Adgrf3 T A 5: 30,197,551 Q493L probably benign Het
Ak6 T C 13: 100,655,669 S207P probably benign Het
Ang A G 14: 51,101,480 D26G probably benign Het
Ang T C 14: 51,101,500 F33L probably damaging Het
Arhgef38 T A 3: 133,140,837 Y389F probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bicd2 C A 13: 49,378,310 H343N probably benign Het
Casp4 G A 9: 5,308,919 probably null Het
Cd22 A G 7: 30,877,678 F68S probably damaging Het
Cd46 T A 1: 195,077,809 Q245L probably benign Het
Cntnap2 A T 6: 47,107,892 R1096* probably null Het
Cntnap3 A G 13: 64,762,002 V763A probably damaging Het
Cyp3a11 T C 5: 145,868,966 T171A probably benign Het
Defa30 A G 8: 21,135,415 Y65C probably damaging Het
Defb18 A T 1: 18,236,651 M27K probably benign Het
Dnah17 A G 11: 118,032,598 S4071P probably benign Het
Dnah7b T A 1: 46,191,783 D1400E probably damaging Het
Dpysl5 C T 5: 30,777,994 T147I probably benign Het
Epm2a A G 10: 11,448,836 E223G probably benign Het
Etl4 T C 2: 20,743,681 S75P probably damaging Het
Fam189a1 A T 7: 64,776,885 probably null Het
Fbxw15 T A 9: 109,557,136 M312L probably benign Het
Fcgr4 C T 1: 171,020,103 T90I probably damaging Het
Fras1 T A 5: 96,552,725 D201E probably benign Het
Gadl1 A T 9: 116,006,508 K335* probably null Het
Gcsam T G 16: 45,619,993 V133G probably damaging Het
Gml G T 15: 74,813,816 L107I possibly damaging Het
Golga2 T A 2: 32,302,897 L409Q probably damaging Het
Gtf2a1l A T 17: 88,694,580 Q241L probably benign Het
Gtf3c3 A G 1: 54,399,260 Y799H probably damaging Het
Guca1b T G 17: 47,391,201 probably benign Het
Igdcc4 C A 9: 65,126,897 H617Q probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itga2b A C 11: 102,460,777 I574S probably benign Het
Kcnk7 A T 19: 5,706,831 I283F probably damaging Het
Kirrel3 T A 9: 35,023,547 L450M probably damaging Het
Lmntd1 A T 6: 145,419,874 S176R probably damaging Het
Lrrc39 C T 3: 116,579,567 T292I probably benign Het
Ltbp1 A T 17: 75,315,024 H801L probably benign Het
Macf1 T A 4: 123,401,403 Q3318L probably damaging Het
Man1b1 T A 2: 25,345,020 N282K probably benign Het
Map2k6 A T 11: 110,497,901 E223V probably damaging Het
Marf1 C A 16: 14,142,586 R531S possibly damaging Het
Mfge8 G A 7: 79,142,443 R245C probably damaging Het
Mgea5 C A 19: 45,752,174 K907N probably benign Het
Mogat1 T G 1: 78,538,044 N318K probably benign Het
Myh4 T A 11: 67,250,309 S732R possibly damaging Het
Myt1l T A 12: 29,811,538 D106E unknown Het
Ndc1 T C 4: 107,384,795 F302L probably damaging Het
Ndrg4 C T 8: 95,712,328 A290V probably benign Het
Nfia A T 4: 98,063,128 K397N probably damaging Het
Nlrp4e A T 7: 23,321,033 Q315L possibly damaging Het
Olfr51 T A 11: 51,007,852 N293K probably damaging Het
Olfr9 A C 10: 128,990,852 *313C probably null Het
Peg3 T C 7: 6,707,781 I1481V possibly damaging Het
Phldb2 C T 16: 45,775,050 G883D probably benign Het
Pik3c2b T A 1: 133,094,826 Y1169N probably damaging Het
Plcl1 A T 1: 55,695,838 I113F probably damaging Het
Pomt2 T C 12: 87,124,836 I457V probably benign Het
Ppil1 T C 17: 29,261,835 N38S possibly damaging Het
Prf1 A G 10: 61,300,452 N169S probably benign Het
Prmt8 A C 6: 127,726,523 probably null Het
Ptprg T A 14: 12,154,360 S694T probably benign Het
Rab12 A T 17: 66,500,320 M138K possibly damaging Het
Reln T C 5: 21,955,095 T2159A probably damaging Het
Retsat A T 6: 72,606,080 Y36F probably damaging Het
Rgs14 A T 13: 55,378,883 Q116L probably damaging Het
Rlbp1 A T 7: 79,375,936 N252K probably damaging Het
Rtraf A G 14: 19,812,174 L215P probably damaging Het
Sec1 A T 7: 45,679,365 M86K probably benign Het
Sec24b A T 3: 130,041,016 S42T possibly damaging Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc35f5 T G 1: 125,584,532 D356E possibly damaging Het
Smpd4 T C 16: 17,642,501 S694P probably damaging Het
Spag6 G T 2: 18,745,609 probably null Het
Spata31d1c T C 13: 65,033,216 I43T possibly damaging Het
Ssh1 T C 5: 113,952,020 D314G possibly damaging Het
Tnfrsf17 G A 16: 11,319,731 D111N probably benign Het
Ttn A G 2: 76,723,291 I30994T probably damaging Het
Ttn A T 2: 76,783,976 F8737L probably damaging Het
Ush1c G T 7: 46,195,728 F890L probably benign Het
Usp36 C T 11: 118,272,131 probably null Het
Vmn2r115 T C 17: 23,347,821 Y436H probably benign Het
Vmn2r94 T A 17: 18,257,373 M259L probably benign Het
Wwp1 T C 4: 19,659,698 T197A probably benign Het
Zbtb37 T A 1: 161,020,244 M398L probably benign Het
Zfp804b C T 5: 6,769,673 C1130Y probably benign Het
Zfp9 A G 6: 118,464,751 C317R probably damaging Het
Zscan20 T C 4: 128,586,541 H719R probably damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 intron probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R7988:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTAGAGCATCAGGAAGGGTTAC -3'
(R):5'- TCAGCCCCAAGATGGCTACAGATAC -3'

Sequencing Primer
(F):5'- ACTGCCAGGGAATTTTAACCTC -3'
(R):5'- GACTCTATGCAGTACTTACAGAGCAG -3'
Posted On2014-05-14