Incidental Mutation 'R1717:4933434E20Rik'
Institutional Source Beutler Lab
Gene Symbol 4933434E20Rik
Ensembl Gene ENSMUSG00000027942
Gene NameRIKEN cDNA 4933434E20 gene
MMRRC Submission 039750-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1717 (G1)
Quality Score225
Status Validated
Chromosomal Location90051636-90068347 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90056237 bp
Amino Acid Change Serine to Threonine at position 67 (S67T)
Ref Sequence ENSEMBL: ENSMUSP00000124822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029552] [ENSMUST00000029553] [ENSMUST00000064639] [ENSMUST00000068798] [ENSMUST00000090908] [ENSMUST00000159064] [ENSMUST00000160640] [ENSMUST00000161918] [ENSMUST00000162114] [ENSMUST00000196633] [ENSMUST00000197903] [ENSMUST00000198322] [ENSMUST00000199929] [ENSMUST00000196843] [ENSMUST00000195995] [ENSMUST00000199834]
Predicted Effect probably benign
Transcript: ENSMUST00000029552
AA Change: S67T

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029552
Gene: ENSMUSG00000027942
AA Change: S67T

Pfam:NICE-3 1 189 1.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029553
SMART Domains Protein: ENSMUSP00000029553
Gene: ENSMUSG00000042520

low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064639
SMART Domains Protein: ENSMUSP00000066138
Gene: ENSMUSG00000042520

low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 394 403 N/A INTRINSIC
low complexity region 405 414 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Pfam:DUF3697 520 551 4.1e-18 PFAM
low complexity region 559 594 N/A INTRINSIC
low complexity region 670 680 N/A INTRINSIC
low complexity region 719 750 N/A INTRINSIC
low complexity region 753 809 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1043 1056 N/A INTRINSIC
low complexity region 1077 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068798
AA Change: S67T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000066840
Gene: ENSMUSG00000027942
AA Change: S67T

Pfam:NICE-3 1 171 2.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090908
SMART Domains Protein: ENSMUSP00000088424
Gene: ENSMUSG00000042520

low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159064
AA Change: S67T

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124554
Gene: ENSMUSG00000027942
AA Change: S67T

Pfam:NICE-3 6 188 4.2e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159202
SMART Domains Protein: ENSMUSP00000123777
Gene: ENSMUSG00000027942

Pfam:NICE-3 1 61 2.3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160263
Predicted Effect probably benign
Transcript: ENSMUST00000160640
AA Change: S67T

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124028
Gene: ENSMUSG00000027942
AA Change: S67T

Pfam:NICE-3 1 189 3.2e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161874
Predicted Effect probably benign
Transcript: ENSMUST00000161918
SMART Domains Protein: ENSMUSP00000123740
Gene: ENSMUSG00000027942

Pfam:NICE-3 1 64 2.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162114
AA Change: S67T

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124822
Gene: ENSMUSG00000027942
AA Change: S67T

Pfam:NICE-3 1 189 1.4e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162390
Predicted Effect probably benign
Transcript: ENSMUST00000196633
SMART Domains Protein: ENSMUSP00000143423
Gene: ENSMUSG00000042520

low complexity region 16 30 N/A INTRINSIC
UBA 50 88 6.3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197903
SMART Domains Protein: ENSMUSP00000143519
Gene: ENSMUSG00000042520

low complexity region 16 30 N/A INTRINSIC
PDB:1WJ7|A 31 81 7e-32 PDB
Blast:UBA 50 81 7e-16 BLAST
SCOP:d1efub3 51 81 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198322
SMART Domains Protein: ENSMUSP00000142524
Gene: ENSMUSG00000042520

low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 369 378 N/A INTRINSIC
low complexity region 380 389 N/A INTRINSIC
low complexity region 439 464 N/A INTRINSIC
Pfam:DUF3697 494 526 4.1e-22 PFAM
low complexity region 534 569 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
low complexity region 694 725 N/A INTRINSIC
low complexity region 728 784 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199929
SMART Domains Protein: ENSMUSP00000142488
Gene: ENSMUSG00000042520

low complexity region 16 30 N/A INTRINSIC
PDB:1WJ7|A 31 57 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000196843
SMART Domains Protein: ENSMUSP00000143459
Gene: ENSMUSG00000042520

low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
low complexity region 1072 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195995
SMART Domains Protein: ENSMUSP00000143638
Gene: ENSMUSG00000042520

low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 526 557 3.7e-18 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199834
SMART Domains Protein: ENSMUSP00000143254
Gene: ENSMUSG00000042520

low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Meta Mutation Damage Score 0.2328 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,664 D616G probably damaging Het
4930583I09Rik T C 17: 64,834,449 N53S unknown Het
9230019H11Rik A T 10: 3,125,050 noncoding transcript Het
Abcc8 T C 7: 46,115,815 I1127V possibly damaging Het
Abcg3 G A 5: 104,963,555 Q349* probably null Het
Adam2 A G 14: 66,068,558 L158P probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap11 C A 14: 78,513,348 S533I probably benign Het
Aldh1a2 A T 9: 71,293,671 N517I probably damaging Het
Aldh4a1 A T 4: 139,638,529 H277L possibly damaging Het
Aldh4a1 G A 4: 139,633,994 probably null Het
Ankrd27 A G 7: 35,628,446 D742G possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,712 probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Arvcf A G 16: 18,401,569 K568E possibly damaging Het
Atp8b3 G A 10: 80,528,797 R521W probably damaging Het
Casp16-ps A G 17: 23,552,050 I127T possibly damaging Het
Cd163 A G 6: 124,329,588 probably benign Het
Cdh8 A T 8: 99,030,705 S754T probably damaging Het
Cel A G 2: 28,556,777 Y461H probably damaging Het
Chmp4b A G 2: 154,657,320 I47V possibly damaging Het
Col1a1 A G 11: 94,948,392 M989V unknown Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Csmd1 A T 8: 17,216,692 S73T possibly damaging Het
Csnk2a2 T C 8: 95,455,808 probably null Het
Dact2 A T 17: 14,197,913 W177R probably benign Het
Ddx10 A G 9: 53,159,953 V680A probably benign Het
Eif5 T A 12: 111,542,217 D215E probably benign Het
Evpl C T 11: 116,225,492 A817T probably benign Het
Fmo6 T A 1: 162,926,252 R131* probably null Het
Fsd2 T C 7: 81,535,109 T680A probably benign Het
Fsip2 T C 2: 82,974,945 V536A possibly damaging Het
Fzd8 T C 18: 9,214,364 F482S probably damaging Het
Gabrb1 A T 5: 72,108,351 probably null Het
Galnt9 T G 5: 110,596,212 I304S probably benign Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm5334 A C 7: 68,618,977 noncoding transcript Het
Grcc10 A T 6: 124,740,513 probably benign Het
Hmcn1 T C 1: 150,859,186 T192A probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irgm2 T A 11: 58,220,635 L396Q probably damaging Het
Ksr2 T A 5: 117,671,449 C426S probably damaging Het
Lair1 A G 7: 4,010,789 F153S probably damaging Het
Lrp1 T C 10: 127,556,269 H2835R possibly damaging Het
Lrp1 T C 10: 127,563,665 T2325A probably damaging Het
Lrrd1 T C 5: 3,850,580 F295S probably damaging Het
Meis1 T A 11: 19,010,608 probably benign Het
Mkln1 T A 6: 31,507,644 I156K probably benign Het
Mmd2 T C 5: 142,575,350 probably benign Het
Morc1 A G 16: 48,452,477 I156V probably benign Het
Muc4 A G 16: 32,753,405 T1094A possibly damaging Het
Nckap1 A G 2: 80,512,670 probably benign Het
Neb A G 2: 52,308,747 I394T possibly damaging Het
Olfr1111 A T 2: 87,149,806 L285* probably null Het
Olfr1112 A T 2: 87,191,903 N72I probably benign Het
Olfr1509 T C 14: 52,450,839 V142A probably benign Het
Olfr331 T A 11: 58,502,059 M166L probably benign Het
Olfr933 C T 9: 38,976,410 L245F probably damaging Het
Pcdha1 T C 18: 36,932,184 S634P probably benign Het
Pcdhb12 T A 18: 37,436,788 V329E probably damaging Het
Pcf11 A T 7: 92,663,585 D193E probably benign Het
Pcsk1 G C 13: 75,110,828 M240I probably damaging Het
Pdc T A 1: 150,333,141 I125N probably damaging Het
Plch2 C T 4: 154,998,272 G564S probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Riok1 T A 13: 38,052,950 I389N probably damaging Het
Ror1 T A 4: 100,302,938 S50R probably benign Het
Samd13 T C 3: 146,646,315 T75A probably benign Het
Siglec1 G A 2: 131,073,956 H1329Y possibly damaging Het
Siglec1 T C 2: 131,084,012 N258S probably damaging Het
Slbp G A 5: 33,645,602 A126V probably benign Het
Slc12a4 A T 8: 105,947,571 probably null Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Synpo2 C A 3: 123,112,554 V1038F probably damaging Het
Tbk1 G A 10: 121,561,645 T374I probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem190 T C 7: 4,784,133 L112P probably damaging Het
Tsc2 C T 17: 24,597,068 R1715Q probably damaging Het
Vmn1r46 T C 6: 89,976,829 L220P probably damaging Het
Vwa3a A G 7: 120,793,386 Q816R probably benign Het
Zfhx4 T C 3: 5,403,104 I2799T probably benign Het
Zfp105 T C 9: 122,930,631 S456P probably damaging Het
Other mutations in 4933434E20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:4933434E20Rik APN 3 90053093 missense possibly damaging 0.65
IGL01621:4933434E20Rik APN 3 90064502 missense possibly damaging 0.82
IGL01984:4933434E20Rik APN 3 90063230 missense probably benign 0.00
IGL02005:4933434E20Rik APN 3 90058620 missense probably damaging 1.00
R0446:4933434E20Rik UTSW 3 90064459 missense probably benign 0.00
R1816:4933434E20Rik UTSW 3 90053091 missense possibly damaging 0.89
R2170:4933434E20Rik UTSW 3 90056304 missense probably benign 0.07
R2299:4933434E20Rik UTSW 3 90064538 missense possibly damaging 0.88
R2981:4933434E20Rik UTSW 3 90058631 missense probably benign 0.00
R3879:4933434E20Rik UTSW 3 90063254 unclassified probably benign
R4065:4933434E20Rik UTSW 3 90058766 nonsense probably null
R4724:4933434E20Rik UTSW 3 90053541 missense probably damaging 1.00
R4724:4933434E20Rik UTSW 3 90053542 missense probably damaging 1.00
R4724:4933434E20Rik UTSW 3 90053583 missense probably damaging 0.99
R4835:4933434E20Rik UTSW 3 90063209 missense probably benign 0.22
R5076:4933434E20Rik UTSW 3 90056252 missense probably benign 0.01
R6126:4933434E20Rik UTSW 3 90056574 missense probably damaging 0.98
R6337:4933434E20Rik UTSW 3 90061733 missense probably benign 0.03
R6562:4933434E20Rik UTSW 3 90063236 missense probably benign 0.38
R7312:4933434E20Rik UTSW 3 90061714 missense probably benign 0.07
R7316:4933434E20Rik UTSW 3 90061713 missense probably benign
R7473:4933434E20Rik UTSW 3 90058653 critical splice donor site probably null
R7990:4933434E20Rik UTSW 3 90063242 missense probably damaging 0.98
R8125:4933434E20Rik UTSW 3 90065511 missense possibly damaging 0.92
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cctcagaaatccaataatctcacac -3'
Posted On2014-05-14