Mutagenetix > Incidental Mutation

Incidental Mutation 'R1718:Pla2g4a'

191178

Institutional Source

Beutler Lab

Gene Symbol

Pla2g4a

Ensembl Gene

ENSMUSG00000056220

Gene Name

phospholipase A2, group IVA (cytosolic, calcium-dependent)

Synonyms

Type IV PLA2, cytosolic phospholipase A2, Pla2g4, cytosolic PLA2, cPLA2alpha, cPLA2

MMRRC Submission

039751-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.253) question?

Stock #

R1718 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

149829618-149961290 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 149871523 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000107557 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070200] [ENSMUST00000111926]

AlphaFold

P47713

Predicted Effect

probably benign
Transcript: ENSMUST00000070200

SMART Domains

Protein: ENSMUSP00000070868
Gene: ENSMUSG00000056220

Domain	Start	End	E-Value	Type
C2	19	121	8.23e-17	SMART
PLAc	117	668	N/A	SMART
Blast:PLAc	706	748	3e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000111926

SMART Domains

Protein: ENSMUSP00000107557
Gene: ENSMUSG00000056220

Domain	Start	End	E-Value	Type
C2	11	113	8.23e-17	SMART
PLAc	109	660	N/A	SMART
Blast:PLAc	698	740	3e-10	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.5%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the phospholipase A2 group IV family. This enzyme hydrolyzes membrane phospholipids, thereby releasing the polyunsaturated fatty acid, arachidonic acid. Arachidonic acid is further metabolized into eicosanoids such as leukotrienes, thromboxanes and prostaglandins, that play important roles in regulating diverse biological processes such as inflammatory responses, membrane and actin dynamics, and tumorigenesis. A rise in intracellular calcium levels results in binding of calcium to the C2 domain of this protein, and triggers the translocation from the cytosol to intracellular membranes, including the Golgi apparatus. Disruption of this gene in mice led to decreased levels of eicosonaoids and platelet-activating factor, decreased allergic symptoms, and impaired reproductive ability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygouse for disruptions in this gene display reduced allergic and autoimmune reactions. They also display an increased incidence of insulin and reduced female reproductive performance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	T	13: 77,245,370		probably benign	Het
Acot3	T	G	12: 84,053,943		probably null	Het
Acox1	A	T	11: 116,174,682	C523*	probably null	Het
Adamts19	G	A	18: 58,972,825	C764Y	probably damaging	Het
Agrn	GCTCT	GCTCTCT	4: 156,166,519		probably null	Het
Apob	A	G	12: 8,016,087	K4319R	probably benign	Het
AU016765	A	C	17: 64,555,438		noncoding transcript	Het
Bpifb1	T	A	2: 154,213,983		probably null	Het
Btn2a2	A	G	13: 23,481,936	V242A	probably benign	Het
Camta1	A	G	4: 151,084,024	S1281P	probably benign	Het
Ccdc116	T	C	16: 17,141,908	K306E	probably benign	Het
Cemip	A	G	7: 83,935,658	V1350A	probably benign	Het
Clip2	A	T	5: 134,502,929	L674*	probably null	Het
Cyp2d12	T	A	15: 82,558,050	D244E	probably benign	Het
Cyp4x1	A	G	4: 115,111,670	V379A	possibly damaging	Het
Dnah9	T	A	11: 66,168,079	H130L	possibly damaging	Het
Enpp7	A	G	11: 118,990,983	Y318C	probably damaging	Het
Fras1	A	T	5: 96,554,889		probably null	Het
Glra3	G	T	8: 55,940,907	A18S	probably benign	Het
Gm28042	T	A	2: 120,036,391	S172T	possibly damaging	Het
Gm7808	T	A	9: 19,928,003		probably benign	Het
Gm8909	A	G	17: 36,161,784		probably benign	Het
Gpr61	C	T	3: 108,150,380	V322M	possibly damaging	Het
Hapln3	A	G	7: 79,123,450	V15A	unknown	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Klk1b4	A	G	7: 44,209,672	Y38C	probably damaging	Het
Lrrfip1	A	G	1: 91,115,555	K561E	probably damaging	Het
Map3k1	A	G	13: 111,755,419	C1101R	probably benign	Het
Mcoln2	A	G	3: 146,190,474		probably benign	Het
Mfsd2b	G	A	12: 4,869,037	T73I	probably damaging	Het
Mfsd4b5	C	T	10: 39,975,203	V19I	probably benign	Het
Mgme1	T	A	2: 144,272,318	D113E	probably benign	Het
Mki67	A	G	7: 135,695,494	S2604P	probably damaging	Het
Mob3c	A	G	4: 115,831,644	I125V	probably benign	Het
Mrps9	G	A	1: 42,903,399	R339H	probably damaging	Het
Ndst1	T	C	18: 60,707,803	D269G	probably damaging	Het
Nedd9	T	C	13: 41,338,926	N30S	probably damaging	Het
Notch4	G	A	17: 34,576,763		probably benign	Het
Olfr1095	A	T	2: 86,851,187	N170K	probably benign	Het
Olfr250	A	G	9: 38,367,594	D6G	probably benign	Het
Olfr877	G	A	9: 37,855,453	V212I	probably benign	Het
Olfr995	T	C	2: 85,438,805	M118V	probably benign	Het
Papss1	C	A	3: 131,619,185	R447S	probably damaging	Het
Rab11fip2	A	G	19: 59,935,649	F266L	probably damaging	Het
Ralgapb	T	A	2: 158,443,280	Y554*	probably null	Het
Rem2	T	C	14: 54,479,150	V240A	probably damaging	Het
Retsat	T	C	6: 72,602,671	V143A	probably benign	Het
Rnf141	G	T	7: 110,821,273	Q175K	probably damaging	Het
Rtcb	C	A	10: 85,942,017	G431V	probably damaging	Het
Slc7a6os	A	G	8: 106,204,339	W222R	probably damaging	Het
Smarcc2	T	C	10: 128,468,998		probably benign	Het
Smchd1	A	T	17: 71,448,833	Y218N	possibly damaging	Het
Sp110	G	A	1: 85,594,385	H66Y	probably benign	Het
Speg	G	A	1: 75,417,863	E1739K	probably benign	Het
Speg	A	G	1: 75,421,744	Q1945R	possibly damaging	Het
Sprtn	T	C	8: 124,898,357	V67A	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Tnks1bp1	G	T	2: 85,071,738	E997D	probably benign	Het
Tti1	A	T	2: 158,008,224	V365E	probably benign	Het
Tulp4	A	G	17: 6,222,440	I590V	probably benign	Het
Vmn2r61	A	G	7: 42,300,697	D847G	probably benign	Het
Zfp184	A	G	13: 21,959,272	T383A	possibly damaging	Het
Zik1	T	A	7: 10,492,341	E33V	probably damaging	Het
Zik1	C	A	7: 10,492,342	E33*	probably null	Het

Other mutations in Pla2g4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Pla2g4a	APN	1	149886203	missense	probably benign	0.08
IGL00763:Pla2g4a	APN	1	149851325	missense	probably damaging	1.00
IGL01548:Pla2g4a	APN	1	149932656	critical splice donor site	probably null
IGL01683:Pla2g4a	APN	1	149857654	missense	probably benign	0.05
IGL01903:Pla2g4a	APN	1	149840619	missense	possibly damaging	0.51
IGL02049:Pla2g4a	APN	1	149861096	missense	probably benign	0.12
IGL02103:Pla2g4a	APN	1	149901199	missense	probably damaging	0.99
IGL03132:Pla2g4a	APN	1	149902284	splice site	probably benign
IGL03299:Pla2g4a	APN	1	149851367	missense	probably damaging	1.00
IGL03302:Pla2g4a	APN	1	149864947	missense	probably benign	0.00
R0110:Pla2g4a	UTSW	1	149840647	missense	possibly damaging	0.67
R0469:Pla2g4a	UTSW	1	149840647	missense	possibly damaging	0.67
R0488:Pla2g4a	UTSW	1	149871445	missense	probably damaging	1.00
R0606:Pla2g4a	UTSW	1	149840704	missense	probably benign	0.44
R1468:Pla2g4a	UTSW	1	149887593	splice site	probably benign
R1470:Pla2g4a	UTSW	1	149840720	missense	probably damaging	1.00
R1470:Pla2g4a	UTSW	1	149840720	missense	probably damaging	1.00
R1521:Pla2g4a	UTSW	1	149857686	critical splice acceptor site	probably null
R1778:Pla2g4a	UTSW	1	149902445	splice site	probably benign
R1967:Pla2g4a	UTSW	1	149922081	missense	probably damaging	1.00
R2063:Pla2g4a	UTSW	1	149840676	missense	possibly damaging	0.94
R2291:Pla2g4a	UTSW	1	149901189	missense	probably damaging	1.00
R3855:Pla2g4a	UTSW	1	149830177	missense	possibly damaging	0.86
R4512:Pla2g4a	UTSW	1	149861051	splice site	probably null
R4568:Pla2g4a	UTSW	1	149842226	missense	probably benign	0.43
R5266:Pla2g4a	UTSW	1	149865167	missense	possibly damaging	0.79
R5855:Pla2g4a	UTSW	1	149880063	missense	probably damaging	0.99
R5897:Pla2g4a	UTSW	1	149865148	missense	probably damaging	0.99
R6012:Pla2g4a	UTSW	1	149932677	missense	possibly damaging	0.55
R6193:Pla2g4a	UTSW	1	149902430	missense	probably damaging	1.00
R6246:Pla2g4a	UTSW	1	149872587	missense	probably damaging	1.00
R6248:Pla2g4a	UTSW	1	149872587	missense	probably damaging	1.00
R6258:Pla2g4a	UTSW	1	149857487	missense	probably benign	0.00
R6260:Pla2g4a	UTSW	1	149857487	missense	probably benign	0.00
R6293:Pla2g4a	UTSW	1	149880047	missense	probably damaging	0.98
R6310:Pla2g4a	UTSW	1	149842226	missense	possibly damaging	0.88
R6490:Pla2g4a	UTSW	1	149851335	nonsense	probably null
R6502:Pla2g4a	UTSW	1	149872616	nonsense	probably null
R6614:Pla2g4a	UTSW	1	149842235	missense	probably benign	0.07
R6671:Pla2g4a	UTSW	1	149887631	missense	probably benign
R6745:Pla2g4a	UTSW	1	149886230	missense	probably benign	0.07
R6880:Pla2g4a	UTSW	1	149851451	missense	possibly damaging	0.90
R7058:Pla2g4a	UTSW	1	149851352	missense	probably damaging	1.00
R7163:Pla2g4a	UTSW	1	149840665	nonsense	probably null
R7422:Pla2g4a	UTSW	1	149932687	missense	probably benign	0.32
R7454:Pla2g4a	UTSW	1	149872690	missense	possibly damaging	0.63
R7474:Pla2g4a	UTSW	1	149865200	missense	possibly damaging	0.88
R7514:Pla2g4a	UTSW	1	149851362	missense	probably damaging	1.00
R7536:Pla2g4a	UTSW	1	149880017	missense	probably damaging	1.00
R7682:Pla2g4a	UTSW	1	149886271	missense	probably damaging	1.00
R7744:Pla2g4a	UTSW	1	149861102	missense	probably benign	0.06
R7766:Pla2g4a	UTSW	1	149861058	missense	probably benign	0.00
R7783:Pla2g4a	UTSW	1	149872744	missense	probably damaging	1.00
R8031:Pla2g4a	UTSW	1	149901213	missense	possibly damaging	0.87
R8145:Pla2g4a	UTSW	1	149840643	missense	probably benign	0.42
R8189:Pla2g4a	UTSW	1	149857586	missense	probably benign	0.04
R8252:Pla2g4a	UTSW	1	149851307	missense	probably damaging	1.00
R8315:Pla2g4a	UTSW	1	149886214	missense	probably benign	0.02
R8762:Pla2g4a	UTSW	1	149886184	missense	probably benign	0.00
R8783:Pla2g4a	UTSW	1	149864990	missense	probably damaging	1.00
R8838:Pla2g4a	UTSW	1	149871505	missense	probably benign	0.00
R9132:Pla2g4a	UTSW	1	149871479	missense	probably benign	0.01
R9282:Pla2g4a	UTSW	1	149871456	missense	probably damaging	1.00
R9412:Pla2g4a	UTSW	1	149880021	missense	probably damaging	0.99
X0021:Pla2g4a	UTSW	1	149864926	missense	possibly damaging	0.66
Z1177:Pla2g4a	UTSW	1	149871434	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCCATTTCAAGGGGTGTTGGGATAA -3'
(R):5'- AGTTGCCAAATCTTCCTCCACTTCAAA -3'

Sequencing Primer
(F):5'- GTGTTGGGATAAATGGAACATACC -3'
(R):5'- GTTGACACAGTCTTCAGAGATTCAG -3'

Posted On

2014-05-14