Incidental Mutation 'R1718:Tti1'
ID 191185
Institutional Source Beutler Lab
Gene Symbol Tti1
Ensembl Gene ENSMUSG00000027650
Gene Name TELO2 interacting protein 1
Synonyms 2610036D13Rik
MMRRC Submission 039751-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.947) question?
Stock # R1718 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 157823723-157870353 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 157850144 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 365 (V365E)
Ref Sequence ENSEMBL: ENSMUSP00000105148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029179] [ENSMUST00000109522] [ENSMUST00000124338]
AlphaFold Q91V83
Predicted Effect probably benign
Transcript: ENSMUST00000029179
AA Change: V365E

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029179
Gene: ENSMUSG00000027650
AA Change: V365E

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
low complexity region 401 411 N/A INTRINSIC
low complexity region 494 504 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
SCOP:d1gw5a_ 855 1044 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109522
AA Change: V365E

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105148
Gene: ENSMUSG00000027650
AA Change: V365E

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
low complexity region 401 411 N/A INTRINSIC
low complexity region 494 504 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
SCOP:d1gw5a_ 855 1044 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124338
SMART Domains Protein: ENSMUSP00000116592
Gene: ENSMUSG00000027650

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126541
Meta Mutation Damage Score 0.2023 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G T 13: 77,393,489 (GRCm39) probably benign Het
Acot3 T G 12: 84,100,717 (GRCm39) probably null Het
Acox1 A T 11: 116,065,508 (GRCm39) C523* probably null Het
Adamts19 G A 18: 59,105,897 (GRCm39) C764Y probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,250,976 (GRCm39) probably null Het
Apob A G 12: 8,066,087 (GRCm39) K4319R probably benign Het
AU016765 A C 17: 64,862,433 (GRCm39) noncoding transcript Het
Bpifb1 T A 2: 154,055,903 (GRCm39) probably null Het
Btn2a2 A G 13: 23,666,106 (GRCm39) V242A probably benign Het
Camta1 A G 4: 151,168,481 (GRCm39) S1281P probably benign Het
Ccdc116 T C 16: 16,959,772 (GRCm39) K306E probably benign Het
Cemip A G 7: 83,584,866 (GRCm39) V1350A probably benign Het
Clip2 A T 5: 134,531,783 (GRCm39) L674* probably null Het
Cyp2d12 T A 15: 82,442,251 (GRCm39) D244E probably benign Het
Cyp4x1 A G 4: 114,968,867 (GRCm39) V379A possibly damaging Het
Dnah9 T A 11: 66,058,905 (GRCm39) H130L possibly damaging Het
Enpp7 A G 11: 118,881,809 (GRCm39) Y318C probably damaging Het
Fras1 A T 5: 96,702,748 (GRCm39) probably null Het
Glra3 G T 8: 56,393,942 (GRCm39) A18S probably benign Het
Gm28042 T A 2: 119,866,872 (GRCm39) S172T possibly damaging Het
Gm7808 T A 9: 19,839,299 (GRCm39) probably benign Het
Gpr61 C T 3: 108,057,696 (GRCm39) V322M possibly damaging Het
H2-T5 A G 17: 36,472,676 (GRCm39) probably benign Het
Hapln3 A G 7: 78,773,198 (GRCm39) V15A unknown Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Klk1b4 A G 7: 43,859,096 (GRCm39) Y38C probably damaging Het
Lrrfip1 A G 1: 91,043,277 (GRCm39) K561E probably damaging Het
Map3k1 A G 13: 111,891,953 (GRCm39) C1101R probably benign Het
Mcoln2 A G 3: 145,896,229 (GRCm39) probably benign Het
Mfsd2b G A 12: 4,919,037 (GRCm39) T73I probably damaging Het
Mfsd4b5 C T 10: 39,851,199 (GRCm39) V19I probably benign Het
Mgme1 T A 2: 144,114,238 (GRCm39) D113E probably benign Het
Mki67 A G 7: 135,297,223 (GRCm39) S2604P probably damaging Het
Mob3c A G 4: 115,688,841 (GRCm39) I125V probably benign Het
Mrps9 G A 1: 42,942,559 (GRCm39) R339H probably damaging Het
Ndst1 T C 18: 60,840,875 (GRCm39) D269G probably damaging Het
Nedd9 T C 13: 41,492,402 (GRCm39) N30S probably damaging Het
Notch4 G A 17: 34,795,737 (GRCm39) probably benign Het
Or5ak25 T C 2: 85,269,149 (GRCm39) M118V probably benign Het
Or5t15 A T 2: 86,681,531 (GRCm39) N170K probably benign Het
Or8b9 G A 9: 37,766,749 (GRCm39) V212I probably benign Het
Or8c10 A G 9: 38,278,890 (GRCm39) D6G probably benign Het
Papss1 C A 3: 131,324,946 (GRCm39) R447S probably damaging Het
Pla2g4a C T 1: 149,747,274 (GRCm39) probably benign Het
Rab11fip2 A G 19: 59,924,081 (GRCm39) F266L probably damaging Het
Ralgapb T A 2: 158,285,200 (GRCm39) Y554* probably null Het
Rem2 T C 14: 54,716,607 (GRCm39) V240A probably damaging Het
Retsat T C 6: 72,579,654 (GRCm39) V143A probably benign Het
Rnf141 G T 7: 110,420,480 (GRCm39) Q175K probably damaging Het
Rtcb C A 10: 85,777,881 (GRCm39) G431V probably damaging Het
Slc7a6os A G 8: 106,930,971 (GRCm39) W222R probably damaging Het
Smarcc2 T C 10: 128,304,867 (GRCm39) probably benign Het
Smchd1 A T 17: 71,755,828 (GRCm39) Y218N possibly damaging Het
Sp110 G A 1: 85,522,106 (GRCm39) H66Y probably benign Het
Speg G A 1: 75,394,507 (GRCm39) E1739K probably benign Het
Speg A G 1: 75,398,388 (GRCm39) Q1945R possibly damaging Het
Sprtn T C 8: 125,625,096 (GRCm39) V67A probably damaging Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Tnks1bp1 G T 2: 84,902,082 (GRCm39) E997D probably benign Het
Tulp4 A G 17: 6,272,715 (GRCm39) I590V probably benign Het
Vmn2r61 A G 7: 41,950,121 (GRCm39) D847G probably benign Het
Zfp184 A G 13: 22,143,442 (GRCm39) T383A possibly damaging Het
Zik1 T A 7: 10,226,268 (GRCm39) E33V probably damaging Het
Zik1 C A 7: 10,226,269 (GRCm39) E33* probably null Het
Other mutations in Tti1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Tti1 APN 2 157,850,885 (GRCm39) missense probably damaging 1.00
IGL00434:Tti1 APN 2 157,850,886 (GRCm39) missense probably damaging 1.00
IGL00820:Tti1 APN 2 157,850,888 (GRCm39) missense probably damaging 1.00
IGL00949:Tti1 APN 2 157,824,319 (GRCm39) missense probably benign 0.00
IGL01080:Tti1 APN 2 157,824,379 (GRCm39) missense probably damaging 1.00
IGL01084:Tti1 APN 2 157,824,379 (GRCm39) missense probably damaging 1.00
IGL01339:Tti1 APN 2 157,851,050 (GRCm39) missense possibly damaging 0.80
IGL01685:Tti1 APN 2 157,842,705 (GRCm39) missense probably benign 0.01
IGL01866:Tti1 APN 2 157,849,618 (GRCm39) missense probably benign 0.27
IGL01903:Tti1 APN 2 157,842,542 (GRCm39) missense probably benign 0.01
IGL03142:Tti1 APN 2 157,842,597 (GRCm39) missense probably damaging 0.99
IGL03173:Tti1 APN 2 157,848,932 (GRCm39) unclassified probably benign
IGL03385:Tti1 APN 2 157,834,945 (GRCm39) missense possibly damaging 0.86
R0413:Tti1 UTSW 2 157,837,396 (GRCm39) missense probably benign 0.00
R0601:Tti1 UTSW 2 157,835,292 (GRCm39) missense probably damaging 0.99
R1760:Tti1 UTSW 2 157,834,955 (GRCm39) missense possibly damaging 0.87
R1761:Tti1 UTSW 2 157,849,617 (GRCm39) missense probably benign 0.01
R1968:Tti1 UTSW 2 157,850,966 (GRCm39) missense possibly damaging 0.66
R2054:Tti1 UTSW 2 157,849,365 (GRCm39) missense possibly damaging 0.79
R2131:Tti1 UTSW 2 157,842,663 (GRCm39) missense probably benign
R3886:Tti1 UTSW 2 157,850,870 (GRCm39) missense possibly damaging 0.74
R4479:Tti1 UTSW 2 157,850,315 (GRCm39) missense possibly damaging 0.95
R4647:Tti1 UTSW 2 157,848,940 (GRCm39) unclassified probably benign
R5124:Tti1 UTSW 2 157,850,115 (GRCm39) missense probably damaging 0.99
R5145:Tti1 UTSW 2 157,850,432 (GRCm39) missense probably benign 0.30
R5852:Tti1 UTSW 2 157,842,593 (GRCm39) missense probably damaging 1.00
R6667:Tti1 UTSW 2 157,850,347 (GRCm39) nonsense probably null
R6714:Tti1 UTSW 2 157,848,971 (GRCm39) missense possibly damaging 0.73
R6719:Tti1 UTSW 2 157,824,220 (GRCm39) missense probably benign 0.01
R7143:Tti1 UTSW 2 157,849,596 (GRCm39) missense probably benign
R7490:Tti1 UTSW 2 157,837,392 (GRCm39) missense probably damaging 1.00
R7540:Tti1 UTSW 2 157,849,916 (GRCm39) missense probably benign 0.43
R7549:Tti1 UTSW 2 157,849,088 (GRCm39) missense probably damaging 1.00
R7641:Tti1 UTSW 2 157,850,949 (GRCm39) missense possibly damaging 0.92
R7654:Tti1 UTSW 2 157,850,474 (GRCm39) missense probably benign 0.00
R7716:Tti1 UTSW 2 157,842,618 (GRCm39) missense probably benign 0.43
R7722:Tti1 UTSW 2 157,849,527 (GRCm39) missense probably benign 0.00
R7898:Tti1 UTSW 2 157,835,390 (GRCm39) missense probably benign 0.00
R8117:Tti1 UTSW 2 157,849,418 (GRCm39) missense probably damaging 1.00
R8145:Tti1 UTSW 2 157,849,509 (GRCm39) nonsense probably null
R8249:Tti1 UTSW 2 157,842,635 (GRCm39) missense probably benign
R8712:Tti1 UTSW 2 157,834,930 (GRCm39) missense probably damaging 1.00
R8784:Tti1 UTSW 2 157,850,514 (GRCm39) missense probably benign 0.02
R8912:Tti1 UTSW 2 157,851,188 (GRCm39) missense probably benign 0.00
R9352:Tti1 UTSW 2 157,842,692 (GRCm39) missense probably benign 0.00
R9725:Tti1 UTSW 2 157,849,304 (GRCm39) missense probably benign 0.13
Z1176:Tti1 UTSW 2 157,824,349 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATCAGTCACCTCTAGCTCCAG -3'
(R):5'- GTAGTTGAGCACAGAGTAGCAGCC -3'

Sequencing Primer
(F):5'- CTCTAGCTCCAGTACTTGGATGAG -3'
(R):5'- AGTAGCAGCCCTGATGATTC -3'
Posted On 2014-05-14