Incidental Mutation 'R1718:Vmn2r61'
ID191200
Institutional Source Beutler Lab
Gene Symbol Vmn2r61
Ensembl Gene ENSMUSG00000090967
Gene Namevomeronasal 2, receptor 61
SynonymsEG637873, Casr-rs2, Gprc2a-rs2
MMRRC Submission 039751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1718 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42260053-42300755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42300697 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 847 (D847G)
Ref Sequence ENSEMBL: ENSMUSP00000129576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166131]
Predicted Effect probably benign
Transcript: ENSMUST00000166131
AA Change: D847G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129576
Gene: ENSMUSG00000090967
AA Change: D847G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 4e-42 PFAM
Pfam:NCD3G 514 567 1.9e-21 PFAM
Pfam:7tm_3 600 835 6.2e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173044
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G T 13: 77,245,370 probably benign Het
Acot3 T G 12: 84,053,943 probably null Het
Acox1 A T 11: 116,174,682 C523* probably null Het
Adamts19 G A 18: 58,972,825 C764Y probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Apob A G 12: 8,016,087 K4319R probably benign Het
AU016765 A C 17: 64,555,438 noncoding transcript Het
Bpifb1 T A 2: 154,213,983 probably null Het
Btn2a2 A G 13: 23,481,936 V242A probably benign Het
Camta1 A G 4: 151,084,024 S1281P probably benign Het
Ccdc116 T C 16: 17,141,908 K306E probably benign Het
Cemip A G 7: 83,935,658 V1350A probably benign Het
Clip2 A T 5: 134,502,929 L674* probably null Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Cyp4x1 A G 4: 115,111,670 V379A possibly damaging Het
Dnah9 T A 11: 66,168,079 H130L possibly damaging Het
Enpp7 A G 11: 118,990,983 Y318C probably damaging Het
Fras1 A T 5: 96,554,889 probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm28042 T A 2: 120,036,391 S172T possibly damaging Het
Gm7808 T A 9: 19,928,003 probably benign Het
Gm8909 A G 17: 36,161,784 probably benign Het
Gpr61 C T 3: 108,150,380 V322M possibly damaging Het
Hapln3 A G 7: 79,123,450 V15A unknown Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klk1b4 A G 7: 44,209,672 Y38C probably damaging Het
Lrrfip1 A G 1: 91,115,555 K561E probably damaging Het
Map3k1 A G 13: 111,755,419 C1101R probably benign Het
Mcoln2 A G 3: 146,190,474 probably benign Het
Mfsd2b G A 12: 4,869,037 T73I probably damaging Het
Mfsd4b5 C T 10: 39,975,203 V19I probably benign Het
Mgme1 T A 2: 144,272,318 D113E probably benign Het
Mki67 A G 7: 135,695,494 S2604P probably damaging Het
Mob3c A G 4: 115,831,644 I125V probably benign Het
Mrps9 G A 1: 42,903,399 R339H probably damaging Het
Ndst1 T C 18: 60,707,803 D269G probably damaging Het
Nedd9 T C 13: 41,338,926 N30S probably damaging Het
Notch4 G A 17: 34,576,763 probably benign Het
Olfr1095 A T 2: 86,851,187 N170K probably benign Het
Olfr250 A G 9: 38,367,594 D6G probably benign Het
Olfr877 G A 9: 37,855,453 V212I probably benign Het
Olfr995 T C 2: 85,438,805 M118V probably benign Het
Papss1 C A 3: 131,619,185 R447S probably damaging Het
Pla2g4a C T 1: 149,871,523 probably benign Het
Rab11fip2 A G 19: 59,935,649 F266L probably damaging Het
Ralgapb T A 2: 158,443,280 Y554* probably null Het
Rem2 T C 14: 54,479,150 V240A probably damaging Het
Retsat T C 6: 72,602,671 V143A probably benign Het
Rnf141 G T 7: 110,821,273 Q175K probably damaging Het
Rtcb C A 10: 85,942,017 G431V probably damaging Het
Slc7a6os A G 8: 106,204,339 W222R probably damaging Het
Smarcc2 T C 10: 128,468,998 probably benign Het
Smchd1 A T 17: 71,448,833 Y218N possibly damaging Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Speg G A 1: 75,417,863 E1739K probably benign Het
Speg A G 1: 75,421,744 Q1945R possibly damaging Het
Sprtn T C 8: 124,898,357 V67A probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tnks1bp1 G T 2: 85,071,738 E997D probably benign Het
Tti1 A T 2: 158,008,224 V365E probably benign Het
Tulp4 A G 17: 6,222,440 I590V probably benign Het
Zfp184 A G 13: 21,959,272 T383A possibly damaging Het
Zik1 T A 7: 10,492,341 E33V probably damaging Het
Zik1 C A 7: 10,492,342 E33* probably null Het
Other mutations in Vmn2r61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r61 APN 7 42300751 missense possibly damaging 0.96
IGL00824:Vmn2r61 APN 7 42267014 missense probably benign 0.03
IGL00903:Vmn2r61 APN 7 42300511 missense probably damaging 1.00
IGL01125:Vmn2r61 APN 7 42260126 missense probably damaging 1.00
IGL01393:Vmn2r61 APN 7 42266834 missense probably benign 0.08
IGL01712:Vmn2r61 APN 7 42260237 missense probably damaging 0.98
IGL01822:Vmn2r61 APN 7 42300706 missense probably benign 0.18
IGL01835:Vmn2r61 APN 7 42300591 missense probably benign 0.12
IGL01844:Vmn2r61 APN 7 42260215 missense probably benign 0.00
IGL01953:Vmn2r61 APN 7 42300189 missense probably damaging 1.00
IGL02032:Vmn2r61 APN 7 42300042 missense probably damaging 0.99
IGL02054:Vmn2r61 APN 7 42276734 critical splice donor site probably null
IGL02569:Vmn2r61 APN 7 42276646 missense probably damaging 1.00
IGL02697:Vmn2r61 APN 7 42275468 missense possibly damaging 0.55
IGL02958:Vmn2r61 APN 7 42299937 missense probably benign
IGL03290:Vmn2r61 APN 7 42265984 missense probably benign 0.00
IGL03337:Vmn2r61 APN 7 42267085 missense possibly damaging 0.58
IGL03369:Vmn2r61 APN 7 42260093 missense probably benign
IGL03402:Vmn2r61 APN 7 42260255 missense probably benign
R0026:Vmn2r61 UTSW 7 42275474 missense possibly damaging 0.64
R0319:Vmn2r61 UTSW 7 42300517 missense probably damaging 0.99
R0433:Vmn2r61 UTSW 7 42265911 missense probably benign 0.02
R0555:Vmn2r61 UTSW 7 42266018 missense probably benign 0.02
R0691:Vmn2r61 UTSW 7 42300420 missense probably damaging 1.00
R1701:Vmn2r61 UTSW 7 42300511 missense probably damaging 1.00
R1835:Vmn2r61 UTSW 7 42266652 nonsense probably null
R1920:Vmn2r61 UTSW 7 42300286 missense possibly damaging 0.73
R2069:Vmn2r61 UTSW 7 42300001 missense probably benign 0.06
R2326:Vmn2r61 UTSW 7 42266863 missense probably damaging 1.00
R2402:Vmn2r61 UTSW 7 42300105 missense possibly damaging 0.90
R3103:Vmn2r61 UTSW 7 42266643 missense possibly damaging 0.73
R3107:Vmn2r61 UTSW 7 42267067 missense possibly damaging 0.82
R4426:Vmn2r61 UTSW 7 42300733 missense probably benign
R4426:Vmn2r61 UTSW 7 42300735 missense probably benign
R4484:Vmn2r61 UTSW 7 42300696 missense probably benign
R4748:Vmn2r61 UTSW 7 42267141 missense probably damaging 0.96
R4835:Vmn2r61 UTSW 7 42267035 missense possibly damaging 0.52
R4863:Vmn2r61 UTSW 7 42300708 missense probably benign 0.03
R4923:Vmn2r61 UTSW 7 42267096 missense probably damaging 1.00
R4968:Vmn2r61 UTSW 7 42300054 missense probably benign 0.14
R5114:Vmn2r61 UTSW 7 42300529 missense possibly damaging 0.92
R5297:Vmn2r61 UTSW 7 42260222 missense probably benign
R5497:Vmn2r61 UTSW 7 42275482 missense possibly damaging 0.95
R5508:Vmn2r61 UTSW 7 42266818 missense possibly damaging 0.52
R5587:Vmn2r61 UTSW 7 42300487 missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 42300493 missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 42267253 missense probably benign 0.00
R5782:Vmn2r61 UTSW 7 42299829 missense probably damaging 1.00
R6136:Vmn2r61 UTSW 7 42267031 missense probably damaging 1.00
R6207:Vmn2r61 UTSW 7 42260192 missense probably benign 0.01
R6265:Vmn2r61 UTSW 7 42266491 missense probably benign 0.01
R6272:Vmn2r61 UTSW 7 42299818 missense probably damaging 1.00
R6355:Vmn2r61 UTSW 7 42267235 missense probably benign 0.00
R6469:Vmn2r61 UTSW 7 42265859 nonsense probably null
R6554:Vmn2r61 UTSW 7 42276715 missense probably damaging 1.00
R6699:Vmn2r61 UTSW 7 42300156 missense probably benign
R6768:Vmn2r61 UTSW 7 42300324 missense probably damaging 1.00
R6824:Vmn2r61 UTSW 7 42299979 missense probably benign 0.10
R6930:Vmn2r61 UTSW 7 42299940 missense probably benign 0.02
R7053:Vmn2r61 UTSW 7 42267133 missense probably damaging 0.96
R7238:Vmn2r61 UTSW 7 42267205 missense possibly damaging 0.73
R7332:Vmn2r61 UTSW 7 42260110 missense probably benign 0.00
R7359:Vmn2r61 UTSW 7 42265983 missense probably benign 0.11
R7553:Vmn2r61 UTSW 7 42266781 missense not run
R7710:Vmn2r61 UTSW 7 42267048 missense probably damaging 1.00
R7732:Vmn2r61 UTSW 7 42266673 missense probably benign
R7839:Vmn2r61 UTSW 7 42266608 missense probably damaging 0.97
R7916:Vmn2r61 UTSW 7 42300511 missense probably damaging 1.00
R8026:Vmn2r61 UTSW 7 42266717 missense probably benign 0.02
Z1088:Vmn2r61 UTSW 7 42299964 missense possibly damaging 0.93
Z1176:Vmn2r61 UTSW 7 42260161 missense possibly damaging 0.46
Z1176:Vmn2r61 UTSW 7 42266742 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGACACCTTCAATGAGGCCAAG -3'
(R):5'- TGCTGACACATCTTCCACAGGAAC -3'

Sequencing Primer
(F):5'- GAGGCCAAGTTCCTTTCATTCAG -3'
(R):5'- TTATGGGACACTAGGCCAAC -3'
Posted On2014-05-14