Mutagenetix > Incidental Mutation

Incidental Mutation 'R1718:Cemip'

191203

Institutional Source

Beutler Lab

Gene Symbol

Cemip

Ensembl Gene

ENSMUSG00000052353

Gene Name

cell migration inducing protein, hyaluronan binding

Synonyms

6330404C01Rik, 9930013L23Rik, 12H19.01.T7

MMRRC Submission

039751-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R1718 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83932857-84086502 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83935658 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1350 (V1350A)

Ref Sequence

ENSEMBL: ENSMUSP00000063277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064174]

AlphaFold

Q8BI06

Predicted Effect

probably benign
Transcript: ENSMUST00000064174
AA Change: V1350A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: V1350A

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
G8	44	166	9.01e-42	SMART
Pfam:ILEI	187	281	2.1e-28	PFAM
Pfam:Mucin2_WxxW	324	403	1.2e-13	PFAM
PbH1	572	594	7.34e3	SMART
PbH1	595	617	3.73e3	SMART
PbH1	719	741	4.11e3	SMART
PbH1	798	819	6.96e2	SMART
Blast:PbH1	844	882	7e-17	BLAST
Blast:PbH1	917	952	2e-15	BLAST
Pfam:ILEI	1244	1334	2.7e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145171

Meta Mutation Damage Score

0.0702

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.5%

Validation Efficiency

100% (69/69)

MGI Phenotype

PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	T	13: 77,245,370		probably benign	Het
Acot3	T	G	12: 84,053,943		probably null	Het
Acox1	A	T	11: 116,174,682	C523*	probably null	Het
Adamts19	G	A	18: 58,972,825	C764Y	probably damaging	Het
Agrn	GCTCT	GCTCTCT	4: 156,166,519		probably null	Het
Apob	A	G	12: 8,016,087	K4319R	probably benign	Het
AU016765	A	C	17: 64,555,438		noncoding transcript	Het
Bpifb1	T	A	2: 154,213,983		probably null	Het
Btn2a2	A	G	13: 23,481,936	V242A	probably benign	Het
Camta1	A	G	4: 151,084,024	S1281P	probably benign	Het
Ccdc116	T	C	16: 17,141,908	K306E	probably benign	Het
Clip2	A	T	5: 134,502,929	L674*	probably null	Het
Cyp2d12	T	A	15: 82,558,050	D244E	probably benign	Het
Cyp4x1	A	G	4: 115,111,670	V379A	possibly damaging	Het
Dnah9	T	A	11: 66,168,079	H130L	possibly damaging	Het
Enpp7	A	G	11: 118,990,983	Y318C	probably damaging	Het
Fras1	A	T	5: 96,554,889		probably null	Het
Glra3	G	T	8: 55,940,907	A18S	probably benign	Het
Gm28042	T	A	2: 120,036,391	S172T	possibly damaging	Het
Gm7808	T	A	9: 19,928,003		probably benign	Het
Gm8909	A	G	17: 36,161,784		probably benign	Het
Gpr61	C	T	3: 108,150,380	V322M	possibly damaging	Het
Hapln3	A	G	7: 79,123,450	V15A	unknown	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Klk1b4	A	G	7: 44,209,672	Y38C	probably damaging	Het
Lrrfip1	A	G	1: 91,115,555	K561E	probably damaging	Het
Map3k1	A	G	13: 111,755,419	C1101R	probably benign	Het
Mcoln2	A	G	3: 146,190,474		probably benign	Het
Mfsd2b	G	A	12: 4,869,037	T73I	probably damaging	Het
Mfsd4b5	C	T	10: 39,975,203	V19I	probably benign	Het
Mgme1	T	A	2: 144,272,318	D113E	probably benign	Het
Mki67	A	G	7: 135,695,494	S2604P	probably damaging	Het
Mob3c	A	G	4: 115,831,644	I125V	probably benign	Het
Mrps9	G	A	1: 42,903,399	R339H	probably damaging	Het
Ndst1	T	C	18: 60,707,803	D269G	probably damaging	Het
Nedd9	T	C	13: 41,338,926	N30S	probably damaging	Het
Notch4	G	A	17: 34,576,763		probably benign	Het
Olfr1095	A	T	2: 86,851,187	N170K	probably benign	Het
Olfr250	A	G	9: 38,367,594	D6G	probably benign	Het
Olfr877	G	A	9: 37,855,453	V212I	probably benign	Het
Olfr995	T	C	2: 85,438,805	M118V	probably benign	Het
Papss1	C	A	3: 131,619,185	R447S	probably damaging	Het
Pla2g4a	C	T	1: 149,871,523		probably benign	Het
Rab11fip2	A	G	19: 59,935,649	F266L	probably damaging	Het
Ralgapb	T	A	2: 158,443,280	Y554*	probably null	Het
Rem2	T	C	14: 54,479,150	V240A	probably damaging	Het
Retsat	T	C	6: 72,602,671	V143A	probably benign	Het
Rnf141	G	T	7: 110,821,273	Q175K	probably damaging	Het
Rtcb	C	A	10: 85,942,017	G431V	probably damaging	Het
Slc7a6os	A	G	8: 106,204,339	W222R	probably damaging	Het
Smarcc2	T	C	10: 128,468,998		probably benign	Het
Smchd1	A	T	17: 71,448,833	Y218N	possibly damaging	Het
Sp110	G	A	1: 85,594,385	H66Y	probably benign	Het
Speg	G	A	1: 75,417,863	E1739K	probably benign	Het
Speg	A	G	1: 75,421,744	Q1945R	possibly damaging	Het
Sprtn	T	C	8: 124,898,357	V67A	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Tnks1bp1	G	T	2: 85,071,738	E997D	probably benign	Het
Tti1	A	T	2: 158,008,224	V365E	probably benign	Het
Tulp4	A	G	17: 6,222,440	I590V	probably benign	Het
Vmn2r61	A	G	7: 42,300,697	D847G	probably benign	Het
Zfp184	A	G	13: 21,959,272	T383A	possibly damaging	Het
Zik1	T	A	7: 10,492,341	E33V	probably damaging	Het
Zik1	C	A	7: 10,492,342	E33*	probably null	Het

Other mutations in Cemip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:Cemip	APN	7	83947280	missense	possibly damaging	0.63
IGL01520:Cemip	APN	7	83948622	missense	probably benign	0.27
IGL01646:Cemip	APN	7	83983232	missense	possibly damaging	0.81
IGL02057:Cemip	APN	7	83987453	missense	probably damaging	1.00
IGL02058:Cemip	APN	7	83997292	missense	probably damaging	0.99
IGL02120:Cemip	APN	7	83951563	missense	probably damaging	0.99
IGL02278:Cemip	APN	7	83937438	missense	probably damaging	1.00
IGL02331:Cemip	APN	7	83963984	critical splice donor site	probably null
IGL02366:Cemip	APN	7	83943641	missense	probably benign	0.08
IGL02434:Cemip	APN	7	83955284	missense	probably damaging	0.98
IGL02622:Cemip	APN	7	83964175	missense	probably damaging	1.00
IGL02958:Cemip	APN	7	83975055	missense	probably damaging	0.99
IGL02979:Cemip	APN	7	84003306	splice site	probably benign
IGL03280:Cemip	APN	7	83987330	splice site	probably benign
IGL03400:Cemip	APN	7	83958516	missense	probably damaging	0.96
IGL03134:Cemip	UTSW	7	83999237	missense	probably damaging	1.00
PIT4618001:Cemip	UTSW	7	83943939	missense	probably benign	0.07
R0149:Cemip	UTSW	7	83964010	missense	probably benign
R0212:Cemip	UTSW	7	83973190	missense	probably damaging	0.99
R0361:Cemip	UTSW	7	83964010	missense	probably benign
R0565:Cemip	UTSW	7	83964110	missense	probably damaging	0.99
R0727:Cemip	UTSW	7	83961578	missense	probably benign	0.00
R1342:Cemip	UTSW	7	83944075	nonsense	probably null
R1456:Cemip	UTSW	7	83998510	missense	possibly damaging	0.96
R1526:Cemip	UTSW	7	83951440	missense	probably damaging	1.00
R1676:Cemip	UTSW	7	83964038	missense	possibly damaging	0.77
R2234:Cemip	UTSW	7	83998562	missense	probably benign	0.02
R2513:Cemip	UTSW	7	83942025	missense	probably benign	0.11
R3788:Cemip	UTSW	7	83943898	missense	probably damaging	1.00
R3964:Cemip	UTSW	7	83951509	missense	probably benign	0.43
R3966:Cemip	UTSW	7	83951509	missense	probably benign	0.43
R4436:Cemip	UTSW	7	83987429	missense	probably null	0.43
R4584:Cemip	UTSW	7	83958539	missense	probably damaging	1.00
R4601:Cemip	UTSW	7	83951618	missense	probably damaging	0.98
R4717:Cemip	UTSW	7	83947280	missense	probably damaging	0.97
R4767:Cemip	UTSW	7	83973306	missense	probably damaging	1.00
R4822:Cemip	UTSW	7	83973241	missense	probably benign	0.27
R4849:Cemip	UTSW	7	83935737	missense	possibly damaging	0.52
R4910:Cemip	UTSW	7	83997411	missense	probably damaging	1.00
R4911:Cemip	UTSW	7	83983253	missense	probably damaging	1.00
R4922:Cemip	UTSW	7	83947100	intron	probably benign
R4924:Cemip	UTSW	7	83952938	missense	probably damaging	1.00
R5090:Cemip	UTSW	7	83942135	missense	probably damaging	1.00
R5310:Cemip	UTSW	7	83992033	missense	probably damaging	1.00
R5327:Cemip	UTSW	7	83955301	missense	probably damaging	0.99
R5378:Cemip	UTSW	7	83958525	missense	probably damaging	1.00
R5444:Cemip	UTSW	7	83982291	missense	probably damaging	0.98
R5644:Cemip	UTSW	7	83989184	missense	probably benign	0.03
R5688:Cemip	UTSW	7	83961641	missense	probably damaging	1.00
R5714:Cemip	UTSW	7	83975179	missense	probably damaging	1.00
R6170:Cemip	UTSW	7	83947230	missense	possibly damaging	0.89
R6505:Cemip	UTSW	7	83951597	nonsense	probably null
R6713:Cemip	UTSW	7	83943637	missense	probably benign	0.03
R6767:Cemip	UTSW	7	83998624	missense	probably damaging	1.00
R6817:Cemip	UTSW	7	83987992	missense	probably damaging	1.00
R6896:Cemip	UTSW	7	83998576	missense	probably damaging	1.00
R6945:Cemip	UTSW	7	83998547	missense	probably damaging	1.00
R7236:Cemip	UTSW	7	83948804	splice site	probably null
R7410:Cemip	UTSW	7	83952834	missense	probably damaging	1.00
R7483:Cemip	UTSW	7	83998576	missense	probably damaging	0.99
R7734:Cemip	UTSW	7	83957664	nonsense	probably null
R7924:Cemip	UTSW	7	83943715	splice site	probably benign
R7962:Cemip	UTSW	7	84003408	start gained	probably benign
R7988:Cemip	UTSW	7	84003408	start gained	probably benign
R7993:Cemip	UTSW	7	83964175	missense	probably damaging	1.00
R8005:Cemip	UTSW	7	84003408	start gained	probably benign
R8077:Cemip	UTSW	7	84003408	start gained	probably benign
R8130:Cemip	UTSW	7	83947176	missense	probably benign
R8131:Cemip	UTSW	7	84003408	start gained	probably benign
R8172:Cemip	UTSW	7	83997225	missense	probably damaging	1.00
R8220:Cemip	UTSW	7	83947160	missense	probably damaging	1.00
R8345:Cemip	UTSW	7	83942165	critical splice acceptor site	probably null
R8391:Cemip	UTSW	7	83955309	missense	probably damaging	0.99
R8492:Cemip	UTSW	7	83973214	missense	probably damaging	0.99
R8496:Cemip	UTSW	7	83951426	missense	probably benign	0.00
R8698:Cemip	UTSW	7	83958582	missense	probably damaging	0.98
R8835:Cemip	UTSW	7	83937443	missense	probably damaging	1.00
R9229:Cemip	UTSW	7	83957625	missense	probably damaging	1.00
RF008:Cemip	UTSW	7	83961635	missense	probably damaging	0.99
T0970:Cemip	UTSW	7	83983146	missense	probably damaging	0.99
X0067:Cemip	UTSW	7	83947208	missense	probably damaging	0.98
Z1177:Cemip	UTSW	7	83947296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTACCGATGAGGCACAGATAG -3'
(R):5'- CAAGTCCTGGCTTGCAGCAATTC -3'

Sequencing Primer
(F):5'- GTTGTAGCATCGGCCAACAC -3'
(R):5'- GGCTTGCAGCAATTCTCTAATAGC -3'

Posted On

2014-05-14