Mutagenetix > Incidental Mutation

Incidental Mutation 'R1718:Mki67'

191205

Institutional Source

Beutler Lab

Gene Symbol

Mki67

Ensembl Gene

ENSMUSG00000031004

Gene Name

antigen identified by monoclonal antibody Ki 67

Synonyms

D630048A14Rik, Ki-67, Ki67

MMRRC Submission

039751-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.829) question?

Stock #

R1718 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135689784-135716361 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135695494 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 2604 (S2604P)

Ref Sequence

ENSEMBL: ENSMUSP00000033310 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033310]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000033310
AA Change: S2604P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: S2604P

Domain	Start	End	E-Value	Type
FHA	26	76	1.03e-11	SMART
Pfam:PP1_bind	462	519	2.8e-20	PFAM
low complexity region	535	545	N/A	INTRINSIC
low complexity region	869	882	N/A	INTRINSIC
Pfam:K167R	889	982	1.5e-9	PFAM
K167R	993	1102	2.01e-39	SMART
K167R	1107	1217	1.87e-57	SMART
K167R	1228	1337	1.33e-53	SMART
K167R	1348	1451	6.57e-44	SMART
K167R	1462	1570	9.09e-38	SMART
K167R	1580	1686	5.02e-40	SMART
K167R	1697	1807	9.6e-37	SMART
K167R	1818	1926	5.94e-51	SMART
K167R	1937	2047	1.6e-56	SMART
K167R	2058	2164	4.04e-53	SMART
K167R	2175	2285	1.52e-57	SMART
K167R	2296	2407	1.78e-40	SMART
K167R	2418	2527	1.71e-42	SMART
K167R	2538	2640	7.41e-20	SMART
K167R	2642	2750	1.06e-38	SMART
K167R	2761	2872	2.1e-42	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.5%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	T	13: 77,245,370		probably benign	Het
Acot3	T	G	12: 84,053,943		probably null	Het
Acox1	A	T	11: 116,174,682	C523*	probably null	Het
Adamts19	G	A	18: 58,972,825	C764Y	probably damaging	Het
Agrn	GCTCT	GCTCTCT	4: 156,166,519		probably null	Het
Apob	A	G	12: 8,016,087	K4319R	probably benign	Het
AU016765	A	C	17: 64,555,438		noncoding transcript	Het
Bpifb1	T	A	2: 154,213,983		probably null	Het
Btn2a2	A	G	13: 23,481,936	V242A	probably benign	Het
Camta1	A	G	4: 151,084,024	S1281P	probably benign	Het
Ccdc116	T	C	16: 17,141,908	K306E	probably benign	Het
Cemip	A	G	7: 83,935,658	V1350A	probably benign	Het
Clip2	A	T	5: 134,502,929	L674*	probably null	Het
Cyp2d12	T	A	15: 82,558,050	D244E	probably benign	Het
Cyp4x1	A	G	4: 115,111,670	V379A	possibly damaging	Het
Dnah9	T	A	11: 66,168,079	H130L	possibly damaging	Het
Enpp7	A	G	11: 118,990,983	Y318C	probably damaging	Het
Fras1	A	T	5: 96,554,889		probably null	Het
Glra3	G	T	8: 55,940,907	A18S	probably benign	Het
Gm28042	T	A	2: 120,036,391	S172T	possibly damaging	Het
Gm7808	T	A	9: 19,928,003		probably benign	Het
Gm8909	A	G	17: 36,161,784		probably benign	Het
Gpr61	C	T	3: 108,150,380	V322M	possibly damaging	Het
Hapln3	A	G	7: 79,123,450	V15A	unknown	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Klk1b4	A	G	7: 44,209,672	Y38C	probably damaging	Het
Lrrfip1	A	G	1: 91,115,555	K561E	probably damaging	Het
Map3k1	A	G	13: 111,755,419	C1101R	probably benign	Het
Mcoln2	A	G	3: 146,190,474		probably benign	Het
Mfsd2b	G	A	12: 4,869,037	T73I	probably damaging	Het
Mfsd4b5	C	T	10: 39,975,203	V19I	probably benign	Het
Mgme1	T	A	2: 144,272,318	D113E	probably benign	Het
Mob3c	A	G	4: 115,831,644	I125V	probably benign	Het
Mrps9	G	A	1: 42,903,399	R339H	probably damaging	Het
Ndst1	T	C	18: 60,707,803	D269G	probably damaging	Het
Nedd9	T	C	13: 41,338,926	N30S	probably damaging	Het
Notch4	G	A	17: 34,576,763		probably benign	Het
Olfr1095	A	T	2: 86,851,187	N170K	probably benign	Het
Olfr250	A	G	9: 38,367,594	D6G	probably benign	Het
Olfr877	G	A	9: 37,855,453	V212I	probably benign	Het
Olfr995	T	C	2: 85,438,805	M118V	probably benign	Het
Papss1	C	A	3: 131,619,185	R447S	probably damaging	Het
Pla2g4a	C	T	1: 149,871,523		probably benign	Het
Rab11fip2	A	G	19: 59,935,649	F266L	probably damaging	Het
Ralgapb	T	A	2: 158,443,280	Y554*	probably null	Het
Rem2	T	C	14: 54,479,150	V240A	probably damaging	Het
Retsat	T	C	6: 72,602,671	V143A	probably benign	Het
Rnf141	G	T	7: 110,821,273	Q175K	probably damaging	Het
Rtcb	C	A	10: 85,942,017	G431V	probably damaging	Het
Slc7a6os	A	G	8: 106,204,339	W222R	probably damaging	Het
Smarcc2	T	C	10: 128,468,998		probably benign	Het
Smchd1	A	T	17: 71,448,833	Y218N	possibly damaging	Het
Sp110	G	A	1: 85,594,385	H66Y	probably benign	Het
Speg	G	A	1: 75,417,863	E1739K	probably benign	Het
Speg	A	G	1: 75,421,744	Q1945R	possibly damaging	Het
Sprtn	T	C	8: 124,898,357	V67A	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Tnks1bp1	G	T	2: 85,071,738	E997D	probably benign	Het
Tti1	A	T	2: 158,008,224	V365E	probably benign	Het
Tulp4	A	G	17: 6,222,440	I590V	probably benign	Het
Vmn2r61	A	G	7: 42,300,697	D847G	probably benign	Het
Zfp184	A	G	13: 21,959,272	T383A	possibly damaging	Het
Zik1	T	A	7: 10,492,341	E33V	probably damaging	Het
Zik1	C	A	7: 10,492,342	E33*	probably null	Het

Other mutations in Mki67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Mki67	APN	7	135690120	missense	probably benign	0.32
IGL00264:Mki67	APN	7	135707820	nonsense	probably null
IGL00328:Mki67	APN	7	135696695	missense	probably benign	0.03
IGL00570:Mki67	APN	7	135708101	missense	possibly damaging	0.88
IGL00584:Mki67	APN	7	135695695	missense	probably damaging	1.00
IGL00756:Mki67	APN	7	135698731	missense	possibly damaging	0.76
IGL01063:Mki67	APN	7	135694922	missense	possibly damaging	0.93
IGL01112:Mki67	APN	7	135714016	missense	probably damaging	1.00
IGL01360:Mki67	APN	7	135705776	missense	probably damaging	1.00
IGL01457:Mki67	APN	7	135699546	missense	probably benign	0.00
IGL01686:Mki67	APN	7	135707813	missense	probably benign	0.00
IGL01731:Mki67	APN	7	135696549	missense	probably benign	0.03
IGL01775:Mki67	APN	7	135698276	missense	possibly damaging	0.71
IGL01806:Mki67	APN	7	135698957	missense	probably damaging	0.98
IGL01860:Mki67	APN	7	135698957	missense	probably damaging	0.98
IGL01938:Mki67	APN	7	135694330	missense	probably benign	0.04
IGL02249:Mki67	APN	7	135700522	missense	possibly damaging	0.47
IGL02260:Mki67	APN	7	135701968	missense	probably benign	0.00
IGL02270:Mki67	APN	7	135698632	missense	probably damaging	1.00
IGL02406:Mki67	APN	7	135698793	missense	probably benign	0.00
IGL02499:Mki67	APN	7	135694327	missense	possibly damaging	0.94
IGL02655:Mki67	APN	7	135714019	missense	probably damaging	0.98
IGL02700:Mki67	APN	7	135708202	missense	probably benign	0.02
IGL03370:Mki67	APN	7	135695490	missense	probably benign	0.00
Advisement	UTSW	7	135698194	missense	probably damaging	1.00
chocotoff	UTSW	7	135698899	missense	possibly damaging	0.92
Godiva	UTSW	7	135701962	missense	probably benign	0.10
sees	UTSW	7	135700915	missense	possibly damaging	0.68
Whitman	UTSW	7	135713865	missense	probably damaging	1.00
BB003:Mki67	UTSW	7	135697140	missense	possibly damaging	0.91
BB013:Mki67	UTSW	7	135697140	missense	possibly damaging	0.91
PIT4468001:Mki67	UTSW	7	135699147	missense	probably benign	0.00
R0001:Mki67	UTSW	7	135699172	missense	probably damaging	1.00
R0001:Mki67	UTSW	7	135701019	missense	probably damaging	0.99
R0043:Mki67	UTSW	7	135700581	missense	probably benign	0.16
R0043:Mki67	UTSW	7	135700581	missense	probably benign	0.16
R0102:Mki67	UTSW	7	135713803	missense	probably benign	0.16
R0130:Mki67	UTSW	7	135696459	missense	probably damaging	1.00
R0149:Mki67	UTSW	7	135698424	missense	probably benign	0.00
R0356:Mki67	UTSW	7	135704406	missense	probably benign	0.34
R0482:Mki67	UTSW	7	135699429	missense	possibly damaging	0.60
R0508:Mki67	UTSW	7	135700346	missense	probably benign
R0532:Mki67	UTSW	7	135698164	nonsense	probably null
R0548:Mki67	UTSW	7	135695256	missense	probably damaging	1.00
R0548:Mki67	UTSW	7	135696908	missense	possibly damaging	0.82
R0557:Mki67	UTSW	7	135699261	missense	possibly damaging	0.48
R0627:Mki67	UTSW	7	135708258	missense	probably benign	0.31
R0631:Mki67	UTSW	7	135704388	missense	probably damaging	0.98
R0848:Mki67	UTSW	7	135701043	missense	probably benign	0.21
R1075:Mki67	UTSW	7	135697311	missense	probably benign	0.03
R1105:Mki67	UTSW	7	135701050	missense	probably benign	0.09
R1272:Mki67	UTSW	7	135700414	nonsense	probably null
R1331:Mki67	UTSW	7	135698276	missense	possibly damaging	0.71
R1486:Mki67	UTSW	7	135699720	missense	probably benign	0.00
R1510:Mki67	UTSW	7	135696171	missense	probably benign	0.26
R1573:Mki67	UTSW	7	135695116	missense	possibly damaging	0.93
R1586:Mki67	UTSW	7	135713972	nonsense	probably null
R1599:Mki67	UTSW	7	135699934	missense	probably benign	0.34
R1623:Mki67	UTSW	7	135708818	splice site	probably null
R1706:Mki67	UTSW	7	135700566	missense	probably benign	0.37
R1785:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R1816:Mki67	UTSW	7	135707387	missense	possibly damaging	0.68
R1862:Mki67	UTSW	7	135699361	missense	probably benign	0.09
R1929:Mki67	UTSW	7	135698065	missense	possibly damaging	0.46
R1957:Mki67	UTSW	7	135698399	missense	probably benign	0.01
R1971:Mki67	UTSW	7	135713959	critical splice donor site	probably null
R1998:Mki67	UTSW	7	135705770	missense	probably benign	0.00
R2004:Mki67	UTSW	7	135698509	nonsense	probably null
R2005:Mki67	UTSW	7	135698509	nonsense	probably null
R2006:Mki67	UTSW	7	135698509	nonsense	probably null
R2109:Mki67	UTSW	7	135697863	missense	probably damaging	1.00
R2130:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2131:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2133:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2140:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2141:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2142:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2284:Mki67	UTSW	7	135699945	missense	probably damaging	0.99
R2869:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2869:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2871:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2871:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2913:Mki67	UTSW	7	135700686	missense	possibly damaging	0.71
R3404:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3405:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3406:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3777:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3778:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3787:Mki67	UTSW	7	135700283	missense	possibly damaging	0.93
R3847:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3848:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3853:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3971:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3972:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R4258:Mki67	UTSW	7	135695288	missense	possibly damaging	0.86
R4343:Mki67	UTSW	7	135695118	missense	probably benign	0.10
R4488:Mki67	UTSW	7	135697671	missense	probably benign	0.01
R4528:Mki67	UTSW	7	135695359	missense	probably damaging	1.00
R4713:Mki67	UTSW	7	135695469	missense	probably benign	0.35
R4867:Mki67	UTSW	7	135699856	missense	probably damaging	0.97
R4874:Mki67	UTSW	7	135708771	missense	probably damaging	0.97
R4897:Mki67	UTSW	7	135696745	missense	probably damaging	1.00
R5045:Mki67	UTSW	7	135707904	missense	possibly damaging	0.84
R5306:Mki67	UTSW	7	135714001	missense	probably damaging	1.00
R5309:Mki67	UTSW	7	135700830	missense	probably damaging	1.00
R5312:Mki67	UTSW	7	135700830	missense	probably damaging	1.00
R5379:Mki67	UTSW	7	135697461	missense	possibly damaging	0.95
R5506:Mki67	UTSW	7	135699981	missense	possibly damaging	0.60
R5513:Mki67	UTSW	7	135707750	missense	probably damaging	0.98
R5742:Mki67	UTSW	7	135704373	missense	probably benign	0.20
R5806:Mki67	UTSW	7	135704605	missense	probably damaging	1.00
R6008:Mki67	UTSW	7	135697429	missense	probably damaging	1.00
R6037:Mki67	UTSW	7	135696803	missense	possibly damaging	0.69
R6037:Mki67	UTSW	7	135696803	missense	possibly damaging	0.69
R6221:Mki67	UTSW	7	135697914	missense	probably benign	0.18
R6294:Mki67	UTSW	7	135704590	missense	probably benign	0.09
R6377:Mki67	UTSW	7	135696321	missense	possibly damaging	0.67
R6456:Mki67	UTSW	7	135699475	missense	possibly damaging	0.59
R6608:Mki67	UTSW	7	135698361	missense	probably benign	0.01
R6609:Mki67	UTSW	7	135699829	missense	possibly damaging	0.94
R6648:Mki67	UTSW	7	135697440	missense	probably damaging	1.00
R6901:Mki67	UTSW	7	135708760	splice site	probably null
R6978:Mki67	UTSW	7	135701962	missense	probably benign	0.10
R6985:Mki67	UTSW	7	135713865	missense	probably damaging	1.00
R7076:Mki67	UTSW	7	135705629	missense	probably damaging	0.98
R7217:Mki67	UTSW	7	135704182	missense	probably damaging	1.00
R7239:Mki67	UTSW	7	135700176	missense	possibly damaging	0.91
R7250:Mki67	UTSW	7	135699324	missense	possibly damaging	0.90
R7313:Mki67	UTSW	7	135694671	missense	probably benign	0.29
R7336:Mki67	UTSW	7	135713839	missense	probably benign	0.03
R7422:Mki67	UTSW	7	135698370	missense	probably damaging	1.00
R7451:Mki67	UTSW	7	135699351	missense	probably benign	0.01
R7502:Mki67	UTSW	7	135700783	missense	possibly damaging	0.53
R7513:Mki67	UTSW	7	135693223	missense	probably benign
R7578:Mki67	UTSW	7	135700915	missense	possibly damaging	0.68
R7619:Mki67	UTSW	7	135699377	missense	probably benign	0.01
R7646:Mki67	UTSW	7	135696769	missense	possibly damaging	0.63
R7659:Mki67	UTSW	7	135697426	missense	probably damaging	1.00
R7691:Mki67	UTSW	7	135701992	missense	not run
R7780:Mki67	UTSW	7	135713968	missense	probably benign	0.02
R7796:Mki67	UTSW	7	135698194	missense	probably damaging	1.00
R7904:Mki67	UTSW	7	135693087	missense	possibly damaging	0.90
R7911:Mki67	UTSW	7	135704604	missense	probably damaging	1.00
R7921:Mki67	UTSW	7	135695204	missense	probably benign	0.01
R7926:Mki67	UTSW	7	135697140	missense	possibly damaging	0.91
R7950:Mki67	UTSW	7	135699724	nonsense	probably null
R8130:Mki67	UTSW	7	135697564	missense	probably damaging	1.00
R8145:Mki67	UTSW	7	135694336	missense	probably benign	0.07
R8196:Mki67	UTSW	7	135695508	missense	probably damaging	1.00
R8220:Mki67	UTSW	7	135698121	missense	probably benign	0.03
R8299:Mki67	UTSW	7	135704620	missense	probably damaging	1.00
R8334:Mki67	UTSW	7	135696516	missense	probably damaging	0.98
R8350:Mki67	UTSW	7	135698471	missense	possibly damaging	0.82
R8358:Mki67	UTSW	7	135700126	missense	possibly damaging	0.46
R8529:Mki67	UTSW	7	135713959	critical splice donor site	probably null
R8698:Mki67	UTSW	7	135695208	missense	possibly damaging	0.87
R8700:Mki67	UTSW	7	135705707	missense
R8737:Mki67	UTSW	7	135713775	missense	probably damaging	1.00
R8914:Mki67	UTSW	7	135697866	missense
R8930:Mki67	UTSW	7	135698899	missense	possibly damaging	0.92
R8932:Mki67	UTSW	7	135698899	missense	possibly damaging	0.92
R8972:Mki67	UTSW	7	135695635	missense	possibly damaging	0.54
R8973:Mki67	UTSW	7	135695635	missense	possibly damaging	0.54
R8975:Mki67	UTSW	7	135695635	missense	possibly damaging	0.54
R8975:Mki67	UTSW	7	135698400	missense	probably benign	0.01
R9071:Mki67	UTSW	7	135699476	missense	probably benign	0.00
R9241:Mki67	UTSW	7	135695924	missense	possibly damaging	0.93
R9387:Mki67	UTSW	7	135700649	missense	probably damaging	0.99
R9524:Mki67	UTSW	7	135704184	missense	probably damaging	1.00
R9565:Mki67	UTSW	7	135707504	frame shift	probably null
R9782:Mki67	UTSW	7	135704337	critical splice donor site	probably null
X0020:Mki67	UTSW	7	135714001	missense	probably damaging	0.96
X0065:Mki67	UTSW	7	135713844	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGCTGACAGGCACACTTGCTACTG -3'
(R):5'- TGTTGAGAAAACCCCAAAGATGCCC -3'

Sequencing Primer
(F):5'- ACCTACAGGCTCTTTGAGTG -3'
(R):5'- CAAATCTCCAGAACCTGTGGATAC -3'

Posted On

2014-05-14