Incidental Mutation 'R1718:Ndst1'
ID 191238
Institutional Source Beutler Lab
Gene Symbol Ndst1
Ensembl Gene ENSMUSG00000054008
Gene Name N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonyms Ndst-1, b2b2230Clo, 1200015G06Rik, Hsst, glucosaminyl N-deacetylase/N-sulfotransferase 1
MMRRC Submission 039751-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1718 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 60817566-60881722 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60840875 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 269 (D269G)
Ref Sequence ENSEMBL: ENSMUSP00000126623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169273]
AlphaFold Q3UHN9
Predicted Effect probably damaging
Transcript: ENSMUST00000169273
AA Change: D269G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: D269G

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:HSNSD 25 515 5.1e-254 PFAM
Pfam:Sulfotransfer_1 604 869 2.2e-48 PFAM
Meta Mutation Damage Score 0.8987 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G T 13: 77,393,489 (GRCm39) probably benign Het
Acot3 T G 12: 84,100,717 (GRCm39) probably null Het
Acox1 A T 11: 116,065,508 (GRCm39) C523* probably null Het
Adamts19 G A 18: 59,105,897 (GRCm39) C764Y probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,250,976 (GRCm39) probably null Het
Apob A G 12: 8,066,087 (GRCm39) K4319R probably benign Het
AU016765 A C 17: 64,862,433 (GRCm39) noncoding transcript Het
Bpifb1 T A 2: 154,055,903 (GRCm39) probably null Het
Btn2a2 A G 13: 23,666,106 (GRCm39) V242A probably benign Het
Camta1 A G 4: 151,168,481 (GRCm39) S1281P probably benign Het
Ccdc116 T C 16: 16,959,772 (GRCm39) K306E probably benign Het
Cemip A G 7: 83,584,866 (GRCm39) V1350A probably benign Het
Clip2 A T 5: 134,531,783 (GRCm39) L674* probably null Het
Cyp2d12 T A 15: 82,442,251 (GRCm39) D244E probably benign Het
Cyp4x1 A G 4: 114,968,867 (GRCm39) V379A possibly damaging Het
Dnah9 T A 11: 66,058,905 (GRCm39) H130L possibly damaging Het
Enpp7 A G 11: 118,881,809 (GRCm39) Y318C probably damaging Het
Fras1 A T 5: 96,702,748 (GRCm39) probably null Het
Glra3 G T 8: 56,393,942 (GRCm39) A18S probably benign Het
Gm28042 T A 2: 119,866,872 (GRCm39) S172T possibly damaging Het
Gm7808 T A 9: 19,839,299 (GRCm39) probably benign Het
Gpr61 C T 3: 108,057,696 (GRCm39) V322M possibly damaging Het
H2-T5 A G 17: 36,472,676 (GRCm39) probably benign Het
Hapln3 A G 7: 78,773,198 (GRCm39) V15A unknown Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Klk1b4 A G 7: 43,859,096 (GRCm39) Y38C probably damaging Het
Lrrfip1 A G 1: 91,043,277 (GRCm39) K561E probably damaging Het
Map3k1 A G 13: 111,891,953 (GRCm39) C1101R probably benign Het
Mcoln2 A G 3: 145,896,229 (GRCm39) probably benign Het
Mfsd2b G A 12: 4,919,037 (GRCm39) T73I probably damaging Het
Mfsd4b5 C T 10: 39,851,199 (GRCm39) V19I probably benign Het
Mgme1 T A 2: 144,114,238 (GRCm39) D113E probably benign Het
Mki67 A G 7: 135,297,223 (GRCm39) S2604P probably damaging Het
Mob3c A G 4: 115,688,841 (GRCm39) I125V probably benign Het
Mrps9 G A 1: 42,942,559 (GRCm39) R339H probably damaging Het
Nedd9 T C 13: 41,492,402 (GRCm39) N30S probably damaging Het
Notch4 G A 17: 34,795,737 (GRCm39) probably benign Het
Or5ak25 T C 2: 85,269,149 (GRCm39) M118V probably benign Het
Or5t15 A T 2: 86,681,531 (GRCm39) N170K probably benign Het
Or8b9 G A 9: 37,766,749 (GRCm39) V212I probably benign Het
Or8c10 A G 9: 38,278,890 (GRCm39) D6G probably benign Het
Papss1 C A 3: 131,324,946 (GRCm39) R447S probably damaging Het
Pla2g4a C T 1: 149,747,274 (GRCm39) probably benign Het
Rab11fip2 A G 19: 59,924,081 (GRCm39) F266L probably damaging Het
Ralgapb T A 2: 158,285,200 (GRCm39) Y554* probably null Het
Rem2 T C 14: 54,716,607 (GRCm39) V240A probably damaging Het
Retsat T C 6: 72,579,654 (GRCm39) V143A probably benign Het
Rnf141 G T 7: 110,420,480 (GRCm39) Q175K probably damaging Het
Rtcb C A 10: 85,777,881 (GRCm39) G431V probably damaging Het
Slc7a6os A G 8: 106,930,971 (GRCm39) W222R probably damaging Het
Smarcc2 T C 10: 128,304,867 (GRCm39) probably benign Het
Smchd1 A T 17: 71,755,828 (GRCm39) Y218N possibly damaging Het
Sp110 G A 1: 85,522,106 (GRCm39) H66Y probably benign Het
Speg G A 1: 75,394,507 (GRCm39) E1739K probably benign Het
Speg A G 1: 75,398,388 (GRCm39) Q1945R possibly damaging Het
Sprtn T C 8: 125,625,096 (GRCm39) V67A probably damaging Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Tnks1bp1 G T 2: 84,902,082 (GRCm39) E997D probably benign Het
Tti1 A T 2: 157,850,144 (GRCm39) V365E probably benign Het
Tulp4 A G 17: 6,272,715 (GRCm39) I590V probably benign Het
Vmn2r61 A G 7: 41,950,121 (GRCm39) D847G probably benign Het
Zfp184 A G 13: 22,143,442 (GRCm39) T383A possibly damaging Het
Zik1 T A 7: 10,226,268 (GRCm39) E33V probably damaging Het
Zik1 C A 7: 10,226,269 (GRCm39) E33* probably null Het
Other mutations in Ndst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ndst1 APN 18 60,841,028 (GRCm39) missense probably damaging 1.00
IGL01410:Ndst1 APN 18 60,833,517 (GRCm39) missense probably damaging 1.00
IGL01578:Ndst1 APN 18 60,846,198 (GRCm39) missense probably damaging 1.00
IGL02133:Ndst1 APN 18 60,832,618 (GRCm39) missense probably benign 0.05
IGL03200:Ndst1 APN 18 60,832,611 (GRCm39) missense possibly damaging 0.86
R0631:Ndst1 UTSW 18 60,833,431 (GRCm39) splice site probably benign
R0899:Ndst1 UTSW 18 60,840,954 (GRCm39) missense probably benign 0.00
R1104:Ndst1 UTSW 18 60,830,218 (GRCm39) missense probably damaging 0.98
R1371:Ndst1 UTSW 18 60,840,719 (GRCm39) missense possibly damaging 0.90
R1456:Ndst1 UTSW 18 60,846,277 (GRCm39) missense possibly damaging 0.73
R1511:Ndst1 UTSW 18 60,830,242 (GRCm39) missense possibly damaging 0.61
R1524:Ndst1 UTSW 18 60,831,576 (GRCm39) missense probably damaging 0.99
R1699:Ndst1 UTSW 18 60,828,580 (GRCm39) missense probably damaging 1.00
R1772:Ndst1 UTSW 18 60,835,909 (GRCm39) missense probably damaging 0.99
R1900:Ndst1 UTSW 18 60,845,793 (GRCm39) critical splice donor site probably null
R2079:Ndst1 UTSW 18 60,828,581 (GRCm39) missense probably damaging 1.00
R2105:Ndst1 UTSW 18 60,824,325 (GRCm39) missense probably benign 0.01
R2127:Ndst1 UTSW 18 60,824,280 (GRCm39) missense probably benign 0.00
R2875:Ndst1 UTSW 18 60,823,119 (GRCm39) missense probably damaging 1.00
R3798:Ndst1 UTSW 18 60,846,238 (GRCm39) missense possibly damaging 0.94
R3950:Ndst1 UTSW 18 60,830,211 (GRCm39) missense probably benign 0.12
R3951:Ndst1 UTSW 18 60,830,211 (GRCm39) missense probably benign 0.12
R3952:Ndst1 UTSW 18 60,830,211 (GRCm39) missense probably benign 0.12
R4868:Ndst1 UTSW 18 60,828,548 (GRCm39) missense probably benign 0.07
R4898:Ndst1 UTSW 18 60,825,059 (GRCm39) missense probably benign 0.12
R4988:Ndst1 UTSW 18 60,836,005 (GRCm39) missense probably damaging 0.99
R5271:Ndst1 UTSW 18 60,838,204 (GRCm39) missense probably benign 0.03
R5337:Ndst1 UTSW 18 60,823,079 (GRCm39) missense probably damaging 1.00
R5467:Ndst1 UTSW 18 60,825,093 (GRCm39) missense probably benign
R5830:Ndst1 UTSW 18 60,836,910 (GRCm39) missense probably damaging 1.00
R5968:Ndst1 UTSW 18 60,846,148 (GRCm39) missense probably benign
R6241:Ndst1 UTSW 18 60,836,901 (GRCm39) missense probably damaging 0.99
R6422:Ndst1 UTSW 18 60,836,025 (GRCm39) missense probably benign 0.44
R7099:Ndst1 UTSW 18 60,828,572 (GRCm39) missense possibly damaging 0.88
R7544:Ndst1 UTSW 18 60,830,256 (GRCm39) missense probably damaging 1.00
R8918:Ndst1 UTSW 18 60,825,083 (GRCm39) missense probably benign 0.00
R8951:Ndst1 UTSW 18 60,830,196 (GRCm39) missense probably benign
R9187:Ndst1 UTSW 18 60,824,268 (GRCm39) missense probably benign 0.03
R9374:Ndst1 UTSW 18 60,845,931 (GRCm39) missense probably damaging 0.97
R9526:Ndst1 UTSW 18 60,838,220 (GRCm39) nonsense probably null
R9552:Ndst1 UTSW 18 60,845,931 (GRCm39) missense probably damaging 0.97
R9651:Ndst1 UTSW 18 60,833,539 (GRCm39) missense probably damaging 0.96
V8831:Ndst1 UTSW 18 60,835,999 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCATGACGCACTCTAAGTCTC -3'
(R):5'- TCACCACTGCTCTATGTGACACGG -3'

Sequencing Primer
(F):5'- GACGCACTCTAAGTCTCTCCTTAC -3'
(R):5'- TCTATGTGACACGGCCCAG -3'
Posted On 2014-05-14