Mutagenetix > Incidental Mutation

Incidental Mutation 'R1718:Ndst1'

191238

Institutional Source

Beutler Lab

Gene Symbol

Ndst1

Ensembl Gene

ENSMUSG00000054008

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

Synonyms

glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik

MMRRC Submission

039751-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1718 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60685978-60713389 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60707803 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 269 (D269G)

Ref Sequence

ENSEMBL: ENSMUSP00000126623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169273]

AlphaFold

Q3UHN9

Predicted Effect

probably damaging
Transcript: ENSMUST00000169273
AA Change: D269G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: D269G

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
Pfam:HSNSD	25	515	5.1e-254	PFAM
Pfam:Sulfotransfer_1	604	869	2.2e-48	PFAM

Meta Mutation Damage Score

0.8987

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.5%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	T	13: 77,245,370		probably benign	Het
Acot3	T	G	12: 84,053,943		probably null	Het
Acox1	A	T	11: 116,174,682	C523*	probably null	Het
Adamts19	G	A	18: 58,972,825	C764Y	probably damaging	Het
Agrn	GCTCT	GCTCTCT	4: 156,166,519		probably null	Het
Apob	A	G	12: 8,016,087	K4319R	probably benign	Het
AU016765	A	C	17: 64,555,438		noncoding transcript	Het
Bpifb1	T	A	2: 154,213,983		probably null	Het
Btn2a2	A	G	13: 23,481,936	V242A	probably benign	Het
Camta1	A	G	4: 151,084,024	S1281P	probably benign	Het
Ccdc116	T	C	16: 17,141,908	K306E	probably benign	Het
Cemip	A	G	7: 83,935,658	V1350A	probably benign	Het
Clip2	A	T	5: 134,502,929	L674*	probably null	Het
Cyp2d12	T	A	15: 82,558,050	D244E	probably benign	Het
Cyp4x1	A	G	4: 115,111,670	V379A	possibly damaging	Het
Dnah9	T	A	11: 66,168,079	H130L	possibly damaging	Het
Enpp7	A	G	11: 118,990,983	Y318C	probably damaging	Het
Fras1	A	T	5: 96,554,889		probably null	Het
Glra3	G	T	8: 55,940,907	A18S	probably benign	Het
Gm28042	T	A	2: 120,036,391	S172T	possibly damaging	Het
Gm7808	T	A	9: 19,928,003		probably benign	Het
Gm8909	A	G	17: 36,161,784		probably benign	Het
Gpr61	C	T	3: 108,150,380	V322M	possibly damaging	Het
Hapln3	A	G	7: 79,123,450	V15A	unknown	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Klk1b4	A	G	7: 44,209,672	Y38C	probably damaging	Het
Lrrfip1	A	G	1: 91,115,555	K561E	probably damaging	Het
Map3k1	A	G	13: 111,755,419	C1101R	probably benign	Het
Mcoln2	A	G	3: 146,190,474		probably benign	Het
Mfsd2b	G	A	12: 4,869,037	T73I	probably damaging	Het
Mfsd4b5	C	T	10: 39,975,203	V19I	probably benign	Het
Mgme1	T	A	2: 144,272,318	D113E	probably benign	Het
Mki67	A	G	7: 135,695,494	S2604P	probably damaging	Het
Mob3c	A	G	4: 115,831,644	I125V	probably benign	Het
Mrps9	G	A	1: 42,903,399	R339H	probably damaging	Het
Nedd9	T	C	13: 41,338,926	N30S	probably damaging	Het
Notch4	G	A	17: 34,576,763		probably benign	Het
Olfr1095	A	T	2: 86,851,187	N170K	probably benign	Het
Olfr250	A	G	9: 38,367,594	D6G	probably benign	Het
Olfr877	G	A	9: 37,855,453	V212I	probably benign	Het
Olfr995	T	C	2: 85,438,805	M118V	probably benign	Het
Papss1	C	A	3: 131,619,185	R447S	probably damaging	Het
Pla2g4a	C	T	1: 149,871,523		probably benign	Het
Rab11fip2	A	G	19: 59,935,649	F266L	probably damaging	Het
Ralgapb	T	A	2: 158,443,280	Y554*	probably null	Het
Rem2	T	C	14: 54,479,150	V240A	probably damaging	Het
Retsat	T	C	6: 72,602,671	V143A	probably benign	Het
Rnf141	G	T	7: 110,821,273	Q175K	probably damaging	Het
Rtcb	C	A	10: 85,942,017	G431V	probably damaging	Het
Slc7a6os	A	G	8: 106,204,339	W222R	probably damaging	Het
Smarcc2	T	C	10: 128,468,998		probably benign	Het
Smchd1	A	T	17: 71,448,833	Y218N	possibly damaging	Het
Sp110	G	A	1: 85,594,385	H66Y	probably benign	Het
Speg	G	A	1: 75,417,863	E1739K	probably benign	Het
Speg	A	G	1: 75,421,744	Q1945R	possibly damaging	Het
Sprtn	T	C	8: 124,898,357	V67A	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Tnks1bp1	G	T	2: 85,071,738	E997D	probably benign	Het
Tti1	A	T	2: 158,008,224	V365E	probably benign	Het
Tulp4	A	G	17: 6,222,440	I590V	probably benign	Het
Vmn2r61	A	G	7: 42,300,697	D847G	probably benign	Het
Zfp184	A	G	13: 21,959,272	T383A	possibly damaging	Het
Zik1	T	A	7: 10,492,341	E33V	probably damaging	Het
Zik1	C	A	7: 10,492,342	E33*	probably null	Het

Other mutations in Ndst1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ndst1	APN	18	60707956	missense	probably damaging	1.00
IGL01410:Ndst1	APN	18	60700445	missense	probably damaging	1.00
IGL01578:Ndst1	APN	18	60713126	missense	probably damaging	1.00
IGL02133:Ndst1	APN	18	60699546	missense	probably benign	0.05
IGL03200:Ndst1	APN	18	60699539	missense	possibly damaging	0.86
R0631:Ndst1	UTSW	18	60700359	splice site	probably benign
R0899:Ndst1	UTSW	18	60707882	missense	probably benign	0.00
R1104:Ndst1	UTSW	18	60697146	missense	probably damaging	0.98
R1371:Ndst1	UTSW	18	60707647	missense	possibly damaging	0.90
R1456:Ndst1	UTSW	18	60713205	missense	possibly damaging	0.73
R1511:Ndst1	UTSW	18	60697170	missense	possibly damaging	0.61
R1524:Ndst1	UTSW	18	60698504	missense	probably damaging	0.99
R1699:Ndst1	UTSW	18	60695508	missense	probably damaging	1.00
R1772:Ndst1	UTSW	18	60702837	missense	probably damaging	0.99
R1900:Ndst1	UTSW	18	60712721	critical splice donor site	probably null
R2079:Ndst1	UTSW	18	60695509	missense	probably damaging	1.00
R2105:Ndst1	UTSW	18	60691253	missense	probably benign	0.01
R2127:Ndst1	UTSW	18	60691208	missense	probably benign	0.00
R2875:Ndst1	UTSW	18	60690047	missense	probably damaging	1.00
R3798:Ndst1	UTSW	18	60713166	missense	possibly damaging	0.94
R3950:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3951:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3952:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R4868:Ndst1	UTSW	18	60695476	missense	probably benign	0.07
R4898:Ndst1	UTSW	18	60691987	missense	probably benign	0.12
R4988:Ndst1	UTSW	18	60702933	missense	probably damaging	0.99
R5271:Ndst1	UTSW	18	60705132	missense	probably benign	0.03
R5337:Ndst1	UTSW	18	60690007	missense	probably damaging	1.00
R5467:Ndst1	UTSW	18	60692021	missense	probably benign
R5830:Ndst1	UTSW	18	60703838	missense	probably damaging	1.00
R5968:Ndst1	UTSW	18	60713076	missense	probably benign
R6241:Ndst1	UTSW	18	60703829	missense	probably damaging	0.99
R6422:Ndst1	UTSW	18	60702953	missense	probably benign	0.44
R7099:Ndst1	UTSW	18	60695500	missense	possibly damaging	0.88
R7544:Ndst1	UTSW	18	60697184	missense	probably damaging	1.00
R8918:Ndst1	UTSW	18	60692011	missense	probably benign	0.00
R8951:Ndst1	UTSW	18	60697124	missense	probably benign
R9187:Ndst1	UTSW	18	60691196	missense	probably benign	0.03
R9374:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9526:Ndst1	UTSW	18	60705148	nonsense	probably null
R9552:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9651:Ndst1	UTSW	18	60700467	missense	probably damaging	0.96
V8831:Ndst1	UTSW	18	60702927	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCCATGACGCACTCTAAGTCTC -3'
(R):5'- TCACCACTGCTCTATGTGACACGG -3'

Sequencing Primer
(F):5'- GACGCACTCTAAGTCTCTCCTTAC -3'
(R):5'- TCTATGTGACACGGCCCAG -3'

Posted On

2014-05-14