Mutagenetix > Incidental Mutation

Incidental Mutation 'R1719:Nup160'

191250

Institutional Source

Beutler Lab

Gene Symbol

Nup160

Ensembl Gene

ENSMUSG00000051329

Gene Name

nucleoporin 160

Synonyms

Gtl1-13, 2810011M03Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R1719 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90677215-90736328 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to G at 90700436 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 479 (Y479*)

Ref Sequence

ENSEMBL: ENSMUSP00000059289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057481]

AlphaFold

Q9Z0W3

Predicted Effect

probably null
Transcript: ENSMUST00000057481
AA Change: Y479*

SMART Domains

Protein: ENSMUSP00000059289
Gene: ENSMUSG00000051329
AA Change: Y479*

Domain	Start	End	E-Value	Type
Pfam:Nup160	28	543	9.9e-134	PFAM
low complexity region	695	710	N/A	INTRINSIC
low complexity region	1141	1152	N/A	INTRINSIC
low complexity region	1302	1315	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130629

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136739

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUP160 is 1 of up to 60 proteins that make up the 120-MD nuclear pore complex, which mediates nucleoplasmic transport.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,248,206	M459K	probably damaging	Het
A1cf	A	T	19: 31,927,126	K263M	probably damaging	Het
Adam26a	G	A	8: 43,570,036	T139M	possibly damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Akap9	C	T	5: 3,957,645	Q238*	probably null	Het
Ankrd6	A	T	4: 32,828,774	V85E	probably damaging	Het
Ap2b1	C	A	11: 83,324,604	P125T	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Cblc	A	T	7: 19,790,474	D280E	probably benign	Het
Cdk11b	T	C	4: 155,648,397		probably benign	Het
Cela2a	G	T	4: 141,817,946	F239L	probably damaging	Het
Cfap57	A	T	4: 118,606,631	C342S	probably benign	Het
Clca4a	C	A	3: 144,963,755	W345L	probably damaging	Het
Col6a5	T	C	9: 105,931,293	D852G	unknown	Het
Cyp4a32	T	C	4: 115,611,308	V329A	possibly damaging	Het
Dcaf8	C	T	1: 172,175,495	P287S	probably damaging	Het
Dmxl1	T	A	18: 49,934,637	D2654E	probably damaging	Het
Dpep1	A	T	8: 123,200,747	I347F	possibly damaging	Het
Dtnb	T	A	12: 3,643,936	Y56*	probably null	Het
Duox1	T	C	2: 122,338,644	Y1182H	possibly damaging	Het
Dusp10	T	A	1: 184,037,225	S129R	probably benign	Het
Epcam	G	A	17: 87,642,128	R173Q	probably damaging	Het
Ephb3	A	G	16: 21,220,650	E384G	probably damaging	Het
Exosc10	A	T	4: 148,568,503	D525V	probably damaging	Het
Fam186a	T	A	15: 99,942,346	T2006S	possibly damaging	Het
Fbxw21	T	A	9: 109,148,174	T156S	possibly damaging	Het
Fcrl5	A	G	3: 87,457,397	E568G	probably damaging	Het
Fmn2	C	T	1: 174,608,458		probably benign	Het
Fut9	A	G	4: 25,619,744	F357L	possibly damaging	Het
Gas2l1	G	A	11: 5,064,266	H65Y	probably damaging	Het
Gjd2	A	T	2: 114,013,133	M1K	probably null	Het
Gm12169	T	C	11: 46,526,294	L13P	probably damaging	Het
Gm884	T	A	11: 103,617,071		probably benign	Het
Hdgfl3	T	C	7: 81,899,684	Y149C	probably damaging	Het
Hmcn2	T	C	2: 31,354,721	V730A	probably damaging	Het
Inpp4a	A	T	1: 37,398,799	S223C	probably damaging	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Knl1	T	A	2: 119,071,738	W1307R	probably benign	Het
Kpna3	A	G	14: 61,387,477	L139P	probably damaging	Het
Lama3	T	C	18: 12,479,872		probably null	Het
Lin54	G	A	5: 100,485,249	P192L	possibly damaging	Het
Lpo	T	A	11: 87,809,192		probably null	Het
Lrrd1	T	G	5: 3,850,483		probably null	Het
Nbas	T	A	12: 13,560,977		probably null	Het
Nemp1	G	A	10: 127,696,248	G341D	probably damaging	Het
Nrp1	T	C	8: 128,425,885	F192L	probably damaging	Het
Nufip2	T	A	11: 77,693,090	V610E	probably damaging	Het
Oas1d	A	T	5: 120,919,962	D323V	possibly damaging	Het
Olfr125	A	G	17: 37,835,353	D118G	possibly damaging	Het
Olfr1338	A	G	4: 118,753,600	W315R	possibly damaging	Het
Olfr140	T	C	2: 90,051,784	Y180C	probably damaging	Het
Olfr147	G	A	9: 38,403,254	V127M	possibly damaging	Het
Olfr204	T	A	16: 59,314,706	R234*	probably null	Het
Olfr25	A	T	9: 38,330,507	T307S	probably benign	Het
Olfr677	C	A	7: 105,056,794	H183N	probably damaging	Het
Pcm1	T	A	8: 41,313,359	M1567K	possibly damaging	Het
Pdxk	A	G	10: 78,443,896	V215A	probably benign	Het
Phf12	T	A	11: 78,023,601	L74Q	probably damaging	Het
Plcg1	A	G	2: 160,753,743	E537G	probably null	Het
Plxna2	C	T	1: 194,644,370	P204L	possibly damaging	Het
Ppp3cb	T	G	14: 20,524,063	M236L	probably benign	Het
Qrsl1	A	T	10: 43,896,030	S55T	probably damaging	Het
Rbm5	T	C	9: 107,743,913		probably null	Het
Sipa1l2	A	G	8: 125,444,535	S1403P	probably damaging	Het
Sis	C	T	3: 72,965,604	C67Y	probably damaging	Het
Specc1	A	G	11: 62,128,392	I686V	possibly damaging	Het
Speg	G	A	1: 75,417,863	E1739K	probably benign	Het
Sprtn	C	A	8: 124,901,633	H154Q	probably damaging	Het
St7l	A	G	3: 104,870,987	T147A	probably benign	Het
Stab1	G	A	14: 31,146,028	Q1630*	probably null	Het
Stpg2	A	G	3: 139,232,199	D173G	probably benign	Het
Tcf20	G	A	15: 82,852,777	T1491I	probably benign	Het
Themis2	A	T	4: 132,789,649	I180N	possibly damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	C	T	2: 76,745,634	V24972M	probably damaging	Het
Ttn	A	G	2: 76,807,996	V13980A	probably damaging	Het
Usp5	A	T	6: 124,823,460	M286K	possibly damaging	Het
Vmn2r22	G	A	6: 123,637,843	R263C	possibly damaging	Het
Vmn2r71	T	G	7: 85,621,227	C534G	probably damaging	Het
Wdr60	T	C	12: 116,255,912	I137V	probably benign	Het
Wnk2	C	T	13: 49,060,726	S1460N	possibly damaging	Het
Zfp445	G	A	9: 122,852,642	P745S	probably damaging	Het
Zfp957	C	T	14: 79,213,996	G121D	probably damaging	Het
Zscan4f	A	G	7: 11,401,327	E220G	possibly damaging	Het

Other mutations in Nup160

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Nup160	APN	2	90693106	missense	probably damaging	1.00
IGL00938:Nup160	APN	2	90732827	missense	probably damaging	1.00
IGL01111:Nup160	APN	2	90733209	missense	probably benign	0.00
IGL01140:Nup160	APN	2	90700565	missense	possibly damaging	0.85
IGL01348:Nup160	APN	2	90700428	missense	probably benign	0.05
IGL01361:Nup160	APN	2	90684012	nonsense	probably null
IGL01595:Nup160	APN	2	90729737	missense	probably damaging	1.00
IGL01791:Nup160	APN	2	90703853	missense	probably damaging	1.00
IGL02058:Nup160	APN	2	90729707	missense	probably damaging	1.00
IGL02147:Nup160	APN	2	90703941	missense	probably benign	0.17
IGL02250:Nup160	APN	2	90708870	missense	probably damaging	1.00
IGL02507:Nup160	APN	2	90729735	missense	probably benign	0.08
IGL03108:Nup160	APN	2	90703825	missense	probably benign
R0031:Nup160	UTSW	2	90717587	splice site	probably null
R0365:Nup160	UTSW	2	90708844	missense	probably benign	0.01
R0417:Nup160	UTSW	2	90735427	missense	possibly damaging	0.93
R0781:Nup160	UTSW	2	90733219	splice site	probably benign
R1037:Nup160	UTSW	2	90693902	missense	probably damaging	1.00
R1110:Nup160	UTSW	2	90733219	splice site	probably benign
R1459:Nup160	UTSW	2	90690150	missense	probably damaging	1.00
R1468:Nup160	UTSW	2	90700543	missense	probably benign
R1468:Nup160	UTSW	2	90700543	missense	probably benign
R1478:Nup160	UTSW	2	90679399	start gained	probably benign
R1565:Nup160	UTSW	2	90722061	missense	possibly damaging	0.62
R1617:Nup160	UTSW	2	90679499	missense	probably benign
R1647:Nup160	UTSW	2	90710088	missense	probably damaging	0.99
R1648:Nup160	UTSW	2	90710088	missense	probably damaging	0.99
R1702:Nup160	UTSW	2	90683958	missense	probably damaging	0.96
R2448:Nup160	UTSW	2	90722057	missense	probably damaging	1.00
R3775:Nup160	UTSW	2	90722076	missense	probably benign
R3776:Nup160	UTSW	2	90722076	missense	probably benign
R4600:Nup160	UTSW	2	90685197	critical splice donor site	probably null
R4812:Nup160	UTSW	2	90725691	missense	probably damaging	1.00
R5075:Nup160	UTSW	2	90700174	missense	probably damaging	0.99
R5309:Nup160	UTSW	2	90732832	nonsense	probably null
R5312:Nup160	UTSW	2	90732832	nonsense	probably null
R5447:Nup160	UTSW	2	90725615	missense	possibly damaging	0.82
R5682:Nup160	UTSW	2	90679811	missense	probably benign	0.29
R5726:Nup160	UTSW	2	90717851	missense	probably damaging	1.00
R5771:Nup160	UTSW	2	90723396	missense	probably damaging	1.00
R5825:Nup160	UTSW	2	90679770	critical splice acceptor site	probably null
R5851:Nup160	UTSW	2	90707038	missense	probably benign
R5988:Nup160	UTSW	2	90689209	missense	probably damaging	1.00
R6151:Nup160	UTSW	2	90690105	nonsense	probably null
R6164:Nup160	UTSW	2	90717876	nonsense	probably null
R6356:Nup160	UTSW	2	90711935	splice site	probably null
R6379:Nup160	UTSW	2	90702409	nonsense	probably null
R6519:Nup160	UTSW	2	90718217	missense	probably damaging	0.99
R6755:Nup160	UTSW	2	90700456	missense	probably damaging	1.00
R6989:Nup160	UTSW	2	90707020	missense	probably benign	0.34
R7251:Nup160	UTSW	2	90700174	missense	probably damaging	0.99
R7256:Nup160	UTSW	2	90723355	missense	probably damaging	1.00
R7353:Nup160	UTSW	2	90703952	missense	probably damaging	0.99
R7546:Nup160	UTSW	2	90685058	missense	probably damaging	1.00
R7761:Nup160	UTSW	2	90703112	missense	probably benign
R7768:Nup160	UTSW	2	90700116	missense	probably damaging	1.00
R7959:Nup160	UTSW	2	90713895	critical splice donor site	probably null
R8525:Nup160	UTSW	2	90718096	critical splice donor site	probably null
R8726:Nup160	UTSW	2	90733201	missense	possibly damaging	0.86
R8745:Nup160	UTSW	2	90700119	missense	probably benign	0.03
R8989:Nup160	UTSW	2	90717864	missense	probably damaging	1.00
R9087:Nup160	UTSW	2	90684085	missense	probably benign	0.09
R9147:Nup160	UTSW	2	90703145	missense	probably damaging	1.00
R9148:Nup160	UTSW	2	90703145	missense	probably damaging	1.00
R9149:Nup160	UTSW	2	90722241	intron	probably benign
R9153:Nup160	UTSW	2	90684085	missense	possibly damaging	0.78
R9284:Nup160	UTSW	2	90718031	missense	possibly damaging	0.94
R9435:Nup160	UTSW	2	90729794	missense	probably damaging	1.00
R9537:Nup160	UTSW	2	90729744	missense	possibly damaging	0.80
R9695:Nup160	UTSW	2	90708142	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAGGGACTCCTGACATTTCTGAG -3'
(R):5'- TTGTTGAAGCAGAGGCTGACCTG -3'

Sequencing Primer
(F):5'- AGGCCAGACTTCCTTCAGTG -3'
(R):5'- cctaagggcattcccatgtag -3'

Posted On

2014-05-14