Incidental Mutation 'R1719:Knl1'
ID 191252
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Name kinetochore scaffold 1
Synonyms Casc5, 2310043D08Rik, 5730505K17Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1719 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 118877600-118935982 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118902219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 1307 (W1307R)
Ref Sequence ENSEMBL: ENSMUSP00000097140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380]
AlphaFold Q66JQ7
Predicted Effect probably benign
Transcript: ENSMUST00000028799
AA Change: W1307R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: W1307R

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 1e-13 PDB
low complexity region 426 433 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028802
AA Change: W1307R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: W1307R

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000099542
AA Change: W1307R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: W1307R

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152380
SMART Domains Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 3e-14 PDB
low complexity region 426 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,904,526 (GRCm39) K263M probably damaging Het
Adam26a G A 8: 44,023,073 (GRCm39) T139M possibly damaging Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Akap9 C T 5: 4,007,645 (GRCm39) Q238* probably null Het
Ankrd6 A T 4: 32,828,774 (GRCm39) V85E probably damaging Het
Ap2b1 C A 11: 83,215,430 (GRCm39) P125T probably damaging Het
Arhgef7 C A 8: 11,858,713 (GRCm39) probably null Het
Cblc A T 7: 19,524,399 (GRCm39) D280E probably benign Het
Cdk11b T C 4: 155,732,854 (GRCm39) probably benign Het
Cela2a G T 4: 141,545,257 (GRCm39) F239L probably damaging Het
Cfap57 A T 4: 118,463,828 (GRCm39) C342S probably benign Het
Clca4a C A 3: 144,669,516 (GRCm39) W345L probably damaging Het
Col6a5 T C 9: 105,808,492 (GRCm39) D852G unknown Het
Cyp4a32 T C 4: 115,468,505 (GRCm39) V329A possibly damaging Het
Dcaf8 C T 1: 172,003,062 (GRCm39) P287S probably damaging Het
Dmxl1 T A 18: 50,067,704 (GRCm39) D2654E probably damaging Het
Dpep1 A T 8: 123,927,486 (GRCm39) I347F possibly damaging Het
Dtnb T A 12: 3,693,936 (GRCm39) Y56* probably null Het
Duox1 T C 2: 122,169,125 (GRCm39) Y1182H possibly damaging Het
Dusp10 T A 1: 183,769,422 (GRCm39) S129R probably benign Het
Dync2i1 T C 12: 116,219,532 (GRCm39) I137V probably benign Het
Epcam G A 17: 87,949,556 (GRCm39) R173Q probably damaging Het
Ephb3 A G 16: 21,039,400 (GRCm39) E384G probably damaging Het
Exosc10 A T 4: 148,652,960 (GRCm39) D525V probably damaging Het
Fam186a T A 15: 99,840,227 (GRCm39) T2006S possibly damaging Het
Fbxw21 T A 9: 108,977,242 (GRCm39) T156S possibly damaging Het
Fcrl5 A G 3: 87,364,704 (GRCm39) E568G probably damaging Het
Fmn2 C T 1: 174,436,024 (GRCm39) probably benign Het
Fut9 A G 4: 25,619,744 (GRCm39) F357L possibly damaging Het
Garre1 A T 7: 33,947,631 (GRCm39) M459K probably damaging Het
Gas2l1 G A 11: 5,014,266 (GRCm39) H65Y probably damaging Het
Gjd2 A T 2: 113,843,614 (GRCm39) M1K probably null Het
Hdgfl3 T C 7: 81,549,432 (GRCm39) Y149C probably damaging Het
Hmcn2 T C 2: 31,244,733 (GRCm39) V730A probably damaging Het
Inpp4a A T 1: 37,437,880 (GRCm39) S223C probably damaging Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Kpna3 A G 14: 61,624,926 (GRCm39) L139P probably damaging Het
Lama3 T C 18: 12,612,929 (GRCm39) probably null Het
Lin54 G A 5: 100,633,108 (GRCm39) P192L possibly damaging Het
Lpo T A 11: 87,700,018 (GRCm39) probably null Het
Lrrc37 T A 11: 103,507,897 (GRCm39) probably benign Het
Lrrd1 T G 5: 3,900,483 (GRCm39) probably null Het
Nbas T A 12: 13,610,978 (GRCm39) probably null Het
Nemp1 G A 10: 127,532,117 (GRCm39) G341D probably damaging Het
Nrp1 T C 8: 129,152,366 (GRCm39) F192L probably damaging Het
Nufip2 T A 11: 77,583,916 (GRCm39) V610E probably damaging Het
Nup160 T G 2: 90,530,780 (GRCm39) Y479* probably null Het
Oas1d A T 5: 121,058,025 (GRCm39) D323V possibly damaging Het
Or10ak14 A G 4: 118,610,797 (GRCm39) W315R possibly damaging Het
Or14j1 A G 17: 38,146,244 (GRCm39) D118G possibly damaging Het
Or4c3d T C 2: 89,882,128 (GRCm39) Y180C probably damaging Het
Or52e4 C A 7: 104,706,001 (GRCm39) H183N probably damaging Het
Or5ac22 T A 16: 59,135,069 (GRCm39) R234* probably null Het
Or8b3 G A 9: 38,314,550 (GRCm39) V127M possibly damaging Het
Or8c9 A T 9: 38,241,803 (GRCm39) T307S probably benign Het
Pcm1 T A 8: 41,766,396 (GRCm39) M1567K possibly damaging Het
Pdxk A G 10: 78,279,730 (GRCm39) V215A probably benign Het
Phf12 T A 11: 77,914,427 (GRCm39) L74Q probably damaging Het
Plcg1 A G 2: 160,595,663 (GRCm39) E537G probably null Het
Plxna2 C T 1: 194,326,678 (GRCm39) P204L possibly damaging Het
Ppp3cb T G 14: 20,574,131 (GRCm39) M236L probably benign Het
Qrsl1 A T 10: 43,772,026 (GRCm39) S55T probably damaging Het
Rbm5 T C 9: 107,621,112 (GRCm39) probably null Het
Sipa1l2 A G 8: 126,171,274 (GRCm39) S1403P probably damaging Het
Sis C T 3: 72,872,937 (GRCm39) C67Y probably damaging Het
Specc1 A G 11: 62,019,218 (GRCm39) I686V possibly damaging Het
Speg G A 1: 75,394,507 (GRCm39) E1739K probably benign Het
Sprtn C A 8: 125,628,372 (GRCm39) H154Q probably damaging Het
St7l A G 3: 104,778,303 (GRCm39) T147A probably benign Het
Stab1 G A 14: 30,867,985 (GRCm39) Q1630* probably null Het
Stpg2 A G 3: 138,937,960 (GRCm39) D173G probably benign Het
Tcf20 G A 15: 82,736,978 (GRCm39) T1491I probably benign Het
Themis2 A T 4: 132,516,960 (GRCm39) I180N possibly damaging Het
Timd5 T C 11: 46,417,121 (GRCm39) L13P probably damaging Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Ttn A G 2: 76,638,340 (GRCm39) V13980A probably damaging Het
Ttn C T 2: 76,575,978 (GRCm39) V24972M probably damaging Het
Usp5 A T 6: 124,800,423 (GRCm39) M286K possibly damaging Het
Vmn2r22 G A 6: 123,614,802 (GRCm39) R263C possibly damaging Het
Vmn2r71 T G 7: 85,270,435 (GRCm39) C534G probably damaging Het
Wnk2 C T 13: 49,214,202 (GRCm39) S1460N possibly damaging Het
Zfp445 G A 9: 122,681,707 (GRCm39) P745S probably damaging Het
Zfp957 C T 14: 79,451,436 (GRCm39) G121D probably damaging Het
Zscan4f A G 7: 11,135,254 (GRCm39) E220G possibly damaging Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 118,894,564 (GRCm39) missense probably damaging 0.96
IGL00582:Knl1 APN 2 118,932,980 (GRCm39) missense probably benign 0.19
IGL00666:Knl1 APN 2 118,900,945 (GRCm39) missense probably damaging 0.96
IGL01062:Knl1 APN 2 118,907,461 (GRCm39) missense probably benign 0.33
IGL01395:Knl1 APN 2 118,902,047 (GRCm39) missense probably damaging 0.96
IGL01604:Knl1 APN 2 118,900,482 (GRCm39) missense probably damaging 1.00
IGL01996:Knl1 APN 2 118,934,542 (GRCm39) missense probably damaging 1.00
IGL02086:Knl1 APN 2 118,931,255 (GRCm39) missense probably benign 0.40
IGL02105:Knl1 APN 2 118,902,289 (GRCm39) missense probably benign
IGL02106:Knl1 APN 2 118,902,489 (GRCm39) missense possibly damaging 0.89
IGL02201:Knl1 APN 2 118,899,633 (GRCm39) missense probably benign 0.01
IGL02252:Knl1 APN 2 118,903,021 (GRCm39) missense probably damaging 1.00
IGL02414:Knl1 APN 2 118,900,804 (GRCm39) missense possibly damaging 0.83
IGL02655:Knl1 APN 2 118,901,473 (GRCm39) missense possibly damaging 0.62
IGL02682:Knl1 APN 2 118,908,450 (GRCm39) missense possibly damaging 0.86
IGL02710:Knl1 APN 2 118,901,411 (GRCm39) missense probably damaging 0.99
IGL02877:Knl1 APN 2 118,919,312 (GRCm39) missense probably benign 0.08
IGL03100:Knl1 APN 2 118,931,251 (GRCm39) missense probably damaging 0.99
IGL03210:Knl1 APN 2 118,901,098 (GRCm39) missense probably benign 0.02
IGL03138:Knl1 UTSW 2 118,902,840 (GRCm39) missense probably damaging 0.96
R0023:Knl1 UTSW 2 118,933,030 (GRCm39) missense possibly damaging 0.73
R0064:Knl1 UTSW 2 118,906,724 (GRCm39) missense probably benign 0.00
R0064:Knl1 UTSW 2 118,906,724 (GRCm39) missense probably benign 0.00
R0078:Knl1 UTSW 2 118,900,373 (GRCm39) missense probably benign 0.16
R0178:Knl1 UTSW 2 118,888,886 (GRCm39) splice site probably benign
R0295:Knl1 UTSW 2 118,919,320 (GRCm39) missense probably damaging 1.00
R0433:Knl1 UTSW 2 118,934,542 (GRCm39) missense probably damaging 0.96
R0453:Knl1 UTSW 2 118,898,869 (GRCm39) missense probably damaging 1.00
R0569:Knl1 UTSW 2 118,927,916 (GRCm39) missense possibly damaging 0.95
R0827:Knl1 UTSW 2 118,919,382 (GRCm39) splice site probably benign
R0920:Knl1 UTSW 2 118,900,309 (GRCm39) missense probably benign 0.00
R1120:Knl1 UTSW 2 118,892,856 (GRCm39) missense probably damaging 0.99
R1155:Knl1 UTSW 2 118,901,635 (GRCm39) missense possibly damaging 0.90
R1204:Knl1 UTSW 2 118,901,670 (GRCm39) missense probably benign 0.00
R1241:Knl1 UTSW 2 118,903,054 (GRCm39) missense probably benign 0.03
R1387:Knl1 UTSW 2 118,901,211 (GRCm39) missense possibly damaging 0.93
R1448:Knl1 UTSW 2 118,898,788 (GRCm39) missense probably damaging 1.00
R1469:Knl1 UTSW 2 118,901,827 (GRCm39) missense possibly damaging 0.73
R1469:Knl1 UTSW 2 118,901,827 (GRCm39) missense possibly damaging 0.73
R1721:Knl1 UTSW 2 118,906,815 (GRCm39) missense probably damaging 1.00
R2128:Knl1 UTSW 2 118,902,300 (GRCm39) missense possibly damaging 0.79
R2170:Knl1 UTSW 2 118,918,075 (GRCm39) critical splice donor site probably null
R2227:Knl1 UTSW 2 118,902,481 (GRCm39) missense probably damaging 0.97
R2246:Knl1 UTSW 2 118,902,708 (GRCm39) missense probably damaging 1.00
R2275:Knl1 UTSW 2 118,902,762 (GRCm39) missense probably damaging 0.99
R2508:Knl1 UTSW 2 118,888,849 (GRCm39) nonsense probably null
R3115:Knl1 UTSW 2 118,900,872 (GRCm39) missense possibly damaging 0.53
R3122:Knl1 UTSW 2 118,899,425 (GRCm39) missense probably benign 0.32
R3431:Knl1 UTSW 2 118,892,843 (GRCm39) missense probably damaging 1.00
R3755:Knl1 UTSW 2 118,933,060 (GRCm39) missense probably damaging 1.00
R4461:Knl1 UTSW 2 118,890,080 (GRCm39) missense probably benign 0.00
R4600:Knl1 UTSW 2 118,901,025 (GRCm39) missense possibly damaging 0.90
R4713:Knl1 UTSW 2 118,899,618 (GRCm39) nonsense probably null
R4758:Knl1 UTSW 2 118,902,213 (GRCm39) frame shift probably null
R4762:Knl1 UTSW 2 118,902,417 (GRCm39) missense probably benign 0.01
R4869:Knl1 UTSW 2 118,902,832 (GRCm39) missense possibly damaging 0.73
R4870:Knl1 UTSW 2 118,911,994 (GRCm39) missense probably benign 0.22
R4935:Knl1 UTSW 2 118,899,438 (GRCm39) missense possibly damaging 0.50
R5167:Knl1 UTSW 2 118,900,512 (GRCm39) missense probably damaging 1.00
R5184:Knl1 UTSW 2 118,899,657 (GRCm39) missense probably damaging 1.00
R5293:Knl1 UTSW 2 118,900,176 (GRCm39) missense probably damaging 0.99
R5326:Knl1 UTSW 2 118,898,829 (GRCm39) missense possibly damaging 0.66
R5331:Knl1 UTSW 2 118,900,736 (GRCm39) missense possibly damaging 0.92
R5353:Knl1 UTSW 2 118,901,464 (GRCm39) missense probably benign 0.01
R5493:Knl1 UTSW 2 118,899,211 (GRCm39) missense probably damaging 0.98
R5542:Knl1 UTSW 2 118,898,829 (GRCm39) missense possibly damaging 0.66
R5632:Knl1 UTSW 2 118,900,833 (GRCm39) missense probably damaging 1.00
R5650:Knl1 UTSW 2 118,912,031 (GRCm39) nonsense probably null
R5854:Knl1 UTSW 2 118,900,884 (GRCm39) missense probably benign 0.02
R5979:Knl1 UTSW 2 118,899,841 (GRCm39) missense possibly damaging 0.83
R6086:Knl1 UTSW 2 118,924,549 (GRCm39) missense probably damaging 1.00
R6283:Knl1 UTSW 2 118,900,767 (GRCm39) missense probably damaging 1.00
R6285:Knl1 UTSW 2 118,902,422 (GRCm39) missense probably damaging 1.00
R6313:Knl1 UTSW 2 118,899,799 (GRCm39) missense probably damaging 1.00
R6419:Knl1 UTSW 2 118,899,484 (GRCm39) missense probably benign 0.02
R6608:Knl1 UTSW 2 118,917,093 (GRCm39) missense probably damaging 0.99
R6881:Knl1 UTSW 2 118,925,665 (GRCm39) missense possibly damaging 0.67
R7161:Knl1 UTSW 2 118,901,266 (GRCm39) missense possibly damaging 0.79
R7206:Knl1 UTSW 2 118,899,780 (GRCm39) missense probably benign 0.35
R7270:Knl1 UTSW 2 118,933,003 (GRCm39) missense possibly damaging 0.53
R7276:Knl1 UTSW 2 118,902,167 (GRCm39) missense probably damaging 0.98
R7358:Knl1 UTSW 2 118,901,040 (GRCm39) missense possibly damaging 0.92
R7402:Knl1 UTSW 2 118,925,707 (GRCm39) nonsense probably null
R7408:Knl1 UTSW 2 118,901,073 (GRCm39) missense possibly damaging 0.54
R7475:Knl1 UTSW 2 118,918,027 (GRCm39) missense probably damaging 1.00
R7516:Knl1 UTSW 2 118,901,179 (GRCm39) missense probably damaging 0.99
R7524:Knl1 UTSW 2 118,896,460 (GRCm39) missense probably damaging 1.00
R7559:Knl1 UTSW 2 118,924,487 (GRCm39) missense possibly damaging 0.84
R7607:Knl1 UTSW 2 118,925,614 (GRCm39) missense possibly damaging 0.93
R7745:Knl1 UTSW 2 118,902,037 (GRCm39) missense probably benign 0.13
R7847:Knl1 UTSW 2 118,901,457 (GRCm39) missense probably benign 0.02
R8423:Knl1 UTSW 2 118,900,513 (GRCm39) missense probably damaging 1.00
R8725:Knl1 UTSW 2 118,899,524 (GRCm39) missense probably benign 0.34
R8727:Knl1 UTSW 2 118,899,524 (GRCm39) missense probably benign 0.34
R8995:Knl1 UTSW 2 118,902,990 (GRCm39) missense probably benign 0.11
R9023:Knl1 UTSW 2 118,900,761 (GRCm39) missense probably benign 0.27
R9100:Knl1 UTSW 2 118,899,469 (GRCm39) missense probably benign 0.02
R9102:Knl1 UTSW 2 118,917,973 (GRCm39) missense probably benign 0.22
R9303:Knl1 UTSW 2 118,898,829 (GRCm39) missense possibly damaging 0.83
R9400:Knl1 UTSW 2 118,931,224 (GRCm39) missense probably damaging 0.98
R9426:Knl1 UTSW 2 118,899,979 (GRCm39) missense possibly damaging 0.81
R9583:Knl1 UTSW 2 118,887,782 (GRCm39) missense probably damaging 1.00
R9616:Knl1 UTSW 2 118,907,425 (GRCm39) missense probably damaging 1.00
R9616:Knl1 UTSW 2 118,899,994 (GRCm39) missense probably benign 0.02
R9671:Knl1 UTSW 2 118,901,089 (GRCm39) missense probably damaging 1.00
R9766:Knl1 UTSW 2 118,900,381 (GRCm39) missense probably damaging 1.00
R9782:Knl1 UTSW 2 118,899,910 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCACCTTGTCCTTCAAAAGAAGTCAC -3'
(R):5'- AGTCTAGTGCTCCTTCAGCATTTGC -3'

Sequencing Primer
(F):5'- CGCTGCTTAAAGATGAAGATCC -3'
(R):5'- CATGCGTCTGAATGACTTGTG -3'
Posted On 2014-05-14