Mutagenetix > Incidental Mutation

Incidental Mutation 'R1719:Plcg1'

191254

Institutional Source

Beutler Lab

Gene Symbol

Plcg1

Ensembl Gene

ENSMUSG00000016933

Gene Name

phospholipase C, gamma 1

Synonyms

Cded, Plc-gamma1, Plcg-1, Plc-1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1719 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

160731300-160775760 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 160753743 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 537 (E537G)

Ref Sequence

ENSEMBL: ENSMUSP00000105088 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103115] [ENSMUST00000109462] [ENSMUST00000151590]

AlphaFold

Q62077

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000017077

Predicted Effect

probably null
Transcript: ENSMUST00000103115
AA Change: E537G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933
AA Change: E537G

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
PLCXc	320	464	3.7e-91	SMART
PH	489	680	2.99e1	SMART
SH2	548	645	1.12e-30	SMART
SH2	666	747	3.78e-28	SMART
SH3	794	850	6.49e-16	SMART
PH	804	933	8.93e-2	SMART
PLCYc	953	1070	3.23e-73	SMART
C2	1089	1192	1.37e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109462
AA Change: E537G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933
AA Change: E537G

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
Pfam:EF-hand_like	240	318	5.2e-8	PFAM
PLCXc	320	464	3.7e-91	SMART
PH	489	680	2.99e1	SMART
SH2	548	645	1.12e-30	SMART
SH2	666	747	3.78e-28	SMART
SH3	794	850	6.49e-16	SMART
PH	804	933	8.93e-2	SMART
PLCYc	953	1070	3.23e-73	SMART
C2	1089	1192	1.37e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124652

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129568

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133937

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147254

Predicted Effect

probably benign
Transcript: ENSMUST00000151590

SMART Domains

Protein: ENSMUSP00000133771
Gene: ENSMUSG00000016933

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
Pfam:EF-hand_like	239	318	4.4e-8	PFAM
PLCXc	320	464	3.7e-91	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154038

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173061

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173791

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173335

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with arrested growth and/or abnormal hematopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,248,206	M459K	probably damaging	Het
A1cf	A	T	19: 31,927,126	K263M	probably damaging	Het
Adam26a	G	A	8: 43,570,036	T139M	possibly damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Akap9	C	T	5: 3,957,645	Q238*	probably null	Het
Ankrd6	A	T	4: 32,828,774	V85E	probably damaging	Het
Ap2b1	C	A	11: 83,324,604	P125T	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Cblc	A	T	7: 19,790,474	D280E	probably benign	Het
Cdk11b	T	C	4: 155,648,397		probably benign	Het
Cela2a	G	T	4: 141,817,946	F239L	probably damaging	Het
Cfap57	A	T	4: 118,606,631	C342S	probably benign	Het
Clca4a	C	A	3: 144,963,755	W345L	probably damaging	Het
Col6a5	T	C	9: 105,931,293	D852G	unknown	Het
Cyp4a32	T	C	4: 115,611,308	V329A	possibly damaging	Het
Dcaf8	C	T	1: 172,175,495	P287S	probably damaging	Het
Dmxl1	T	A	18: 49,934,637	D2654E	probably damaging	Het
Dpep1	A	T	8: 123,200,747	I347F	possibly damaging	Het
Dtnb	T	A	12: 3,643,936	Y56*	probably null	Het
Duox1	T	C	2: 122,338,644	Y1182H	possibly damaging	Het
Dusp10	T	A	1: 184,037,225	S129R	probably benign	Het
Epcam	G	A	17: 87,642,128	R173Q	probably damaging	Het
Ephb3	A	G	16: 21,220,650	E384G	probably damaging	Het
Exosc10	A	T	4: 148,568,503	D525V	probably damaging	Het
Fam186a	T	A	15: 99,942,346	T2006S	possibly damaging	Het
Fbxw21	T	A	9: 109,148,174	T156S	possibly damaging	Het
Fcrl5	A	G	3: 87,457,397	E568G	probably damaging	Het
Fmn2	C	T	1: 174,608,458		probably benign	Het
Fut9	A	G	4: 25,619,744	F357L	possibly damaging	Het
Gas2l1	G	A	11: 5,064,266	H65Y	probably damaging	Het
Gjd2	A	T	2: 114,013,133	M1K	probably null	Het
Gm12169	T	C	11: 46,526,294	L13P	probably damaging	Het
Gm884	T	A	11: 103,617,071		probably benign	Het
Hdgfl3	T	C	7: 81,899,684	Y149C	probably damaging	Het
Hmcn2	T	C	2: 31,354,721	V730A	probably damaging	Het
Inpp4a	A	T	1: 37,398,799	S223C	probably damaging	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Knl1	T	A	2: 119,071,738	W1307R	probably benign	Het
Kpna3	A	G	14: 61,387,477	L139P	probably damaging	Het
Lama3	T	C	18: 12,479,872		probably null	Het
Lin54	G	A	5: 100,485,249	P192L	possibly damaging	Het
Lpo	T	A	11: 87,809,192		probably null	Het
Lrrd1	T	G	5: 3,850,483		probably null	Het
Nbas	T	A	12: 13,560,977		probably null	Het
Nemp1	G	A	10: 127,696,248	G341D	probably damaging	Het
Nrp1	T	C	8: 128,425,885	F192L	probably damaging	Het
Nufip2	T	A	11: 77,693,090	V610E	probably damaging	Het
Nup160	T	G	2: 90,700,436	Y479*	probably null	Het
Oas1d	A	T	5: 120,919,962	D323V	possibly damaging	Het
Olfr125	A	G	17: 37,835,353	D118G	possibly damaging	Het
Olfr1338	A	G	4: 118,753,600	W315R	possibly damaging	Het
Olfr140	T	C	2: 90,051,784	Y180C	probably damaging	Het
Olfr147	G	A	9: 38,403,254	V127M	possibly damaging	Het
Olfr204	T	A	16: 59,314,706	R234*	probably null	Het
Olfr25	A	T	9: 38,330,507	T307S	probably benign	Het
Olfr677	C	A	7: 105,056,794	H183N	probably damaging	Het
Pcm1	T	A	8: 41,313,359	M1567K	possibly damaging	Het
Pdxk	A	G	10: 78,443,896	V215A	probably benign	Het
Phf12	T	A	11: 78,023,601	L74Q	probably damaging	Het
Plxna2	C	T	1: 194,644,370	P204L	possibly damaging	Het
Ppp3cb	T	G	14: 20,524,063	M236L	probably benign	Het
Qrsl1	A	T	10: 43,896,030	S55T	probably damaging	Het
Rbm5	T	C	9: 107,743,913		probably null	Het
Sipa1l2	A	G	8: 125,444,535	S1403P	probably damaging	Het
Sis	C	T	3: 72,965,604	C67Y	probably damaging	Het
Specc1	A	G	11: 62,128,392	I686V	possibly damaging	Het
Speg	G	A	1: 75,417,863	E1739K	probably benign	Het
Sprtn	C	A	8: 124,901,633	H154Q	probably damaging	Het
St7l	A	G	3: 104,870,987	T147A	probably benign	Het
Stab1	G	A	14: 31,146,028	Q1630*	probably null	Het
Stpg2	A	G	3: 139,232,199	D173G	probably benign	Het
Tcf20	G	A	15: 82,852,777	T1491I	probably benign	Het
Themis2	A	T	4: 132,789,649	I180N	possibly damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	C	T	2: 76,745,634	V24972M	probably damaging	Het
Ttn	A	G	2: 76,807,996	V13980A	probably damaging	Het
Usp5	A	T	6: 124,823,460	M286K	possibly damaging	Het
Vmn2r22	G	A	6: 123,637,843	R263C	possibly damaging	Het
Vmn2r71	T	G	7: 85,621,227	C534G	probably damaging	Het
Wdr60	T	C	12: 116,255,912	I137V	probably benign	Het
Wnk2	C	T	13: 49,060,726	S1460N	possibly damaging	Het
Zfp445	G	A	9: 122,852,642	P745S	probably damaging	Het
Zfp957	C	T	14: 79,213,996	G121D	probably damaging	Het
Zscan4f	A	G	7: 11,401,327	E220G	possibly damaging	Het

Other mutations in Plcg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Plcg1	APN	2	160757266	missense	probably damaging	1.00
IGL00885:Plcg1	APN	2	160758083	missense	probably benign	0.03
IGL01066:Plcg1	APN	2	160754398	missense	probably damaging	1.00
IGL01356:Plcg1	APN	2	160753893	missense	probably damaging	1.00
IGL01629:Plcg1	APN	2	160758010	missense	possibly damaging	0.69
IGL01732:Plcg1	APN	2	160747779	missense	probably damaging	0.97
IGL01754:Plcg1	APN	2	160761433	missense	probably damaging	1.00
IGL02195:Plcg1	APN	2	160753926	missense	possibly damaging	0.83
IGL02371:Plcg1	APN	2	160753507	missense	probably damaging	0.99
IGL02671:Plcg1	APN	2	160755752	nonsense	probably null
IGL03096:Plcg1	APN	2	160757206	splice site	probably benign
IGL03129:Plcg1	APN	2	160774526	critical splice acceptor site	probably null
IGL03139:Plcg1	APN	2	160748129	critical splice donor site	probably null
IGL03211:Plcg1	APN	2	160759691	missense	possibly damaging	0.82
suscepit	UTSW	2	160753602	splice site	probably null
IGL03047:Plcg1	UTSW	2	160754879	missense	probably damaging	1.00
R0098:Plcg1	UTSW	2	160732000	missense	probably damaging	1.00
R0390:Plcg1	UTSW	2	160752366	missense	probably damaging	1.00
R0413:Plcg1	UTSW	2	160761429	missense	probably damaging	1.00
R0650:Plcg1	UTSW	2	160753363	splice site	probably benign
R0679:Plcg1	UTSW	2	160756910	missense	probably damaging	1.00
R0709:Plcg1	UTSW	2	160751778	splice site	probably null
R1721:Plcg1	UTSW	2	160731920	missense	probably damaging	0.99
R1727:Plcg1	UTSW	2	160748088	missense	probably benign	0.00
R1978:Plcg1	UTSW	2	160752578	splice site	probably null
R2277:Plcg1	UTSW	2	160755805	missense	possibly damaging	0.48
R2698:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R3832:Plcg1	UTSW	2	160754437	missense	possibly damaging	0.95
R4094:Plcg1	UTSW	2	160747841	missense	probably damaging	0.98
R4260:Plcg1	UTSW	2	160751707	critical splice donor site	probably null
R4622:Plcg1	UTSW	2	160747768	splice site	probably benign
R4837:Plcg1	UTSW	2	160750986	missense	probably benign	0.00
R4942:Plcg1	UTSW	2	160753589	splice site	probably null
R5514:Plcg1	UTSW	2	160753355	critical splice donor site	probably null
R5647:Plcg1	UTSW	2	160751668	missense	probably benign	0.45
R5929:Plcg1	UTSW	2	160753602	splice site	probably null
R6303:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R6304:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R6471:Plcg1	UTSW	2	160753710	missense	probably benign	0.10
R6500:Plcg1	UTSW	2	160754567	missense	probably damaging	1.00
R7017:Plcg1	UTSW	2	160758097	missense	probably damaging	1.00
R7113:Plcg1	UTSW	2	160748283	missense	possibly damaging	0.78
R7137:Plcg1	UTSW	2	160753926	missense	possibly damaging	0.83
R7155:Plcg1	UTSW	2	160754380	missense	probably damaging	1.00
R7211:Plcg1	UTSW	2	160731874	missense	probably benign	0.02
R7777:Plcg1	UTSW	2	160754603	missense	possibly damaging	0.89
R7918:Plcg1	UTSW	2	160753665	missense	probably damaging	1.00
R7934:Plcg1	UTSW	2	160774578	missense	possibly damaging	0.53
R8309:Plcg1	UTSW	2	160753933	missense	probably benign	0.00
R8344:Plcg1	UTSW	2	160747896	missense	probably benign	0.00
R8377:Plcg1	UTSW	2	160754922	missense	probably damaging	1.00
R8524:Plcg1	UTSW	2	160761467	critical splice donor site	probably null
R8708:Plcg1	UTSW	2	160754553	splice site	probably benign
R8831:Plcg1	UTSW	2	160747812	missense	probably benign	0.02
R8936:Plcg1	UTSW	2	160748066	missense	probably benign	0.02
R9414:Plcg1	UTSW	2	160761356	missense	possibly damaging	0.80
R9466:Plcg1	UTSW	2	160754600	missense	probably benign
R9608:Plcg1	UTSW	2	160755751	missense	probably benign	0.02
R9755:Plcg1	UTSW	2	160731860	missense	probably benign	0.27
Z1176:Plcg1	UTSW	2	160758127	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTACTTGGAGGACCCCGTGAATC -3'
(R):5'- CCAGAAAGACAGCGTGTAGTCACC -3'

Sequencing Primer
(F):5'- CATGTGAGGTCTAGCTGAGCC -3'
(R):5'- CTCTATGCAGTACTCAGTGAGCAG -3'

Posted On

2014-05-14