Incidental Mutation 'R1719:Ankrd6'
ID 191262
Institutional Source Beutler Lab
Gene Symbol Ankrd6
Ensembl Gene ENSMUSG00000040183
Gene Name ankyrin repeat domain 6
Synonyms diversin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1719 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 32804035-32950841 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32828774 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 85 (V85E)
Ref Sequence ENSEMBL: ENSMUSP00000103801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035719] [ENSMUST00000084748] [ENSMUST00000084749] [ENSMUST00000084750] [ENSMUST00000108166]
AlphaFold Q69ZU8
Predicted Effect probably damaging
Transcript: ENSMUST00000035719
AA Change: V85E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041300
Gene: ENSMUSG00000040183
AA Change: V85E

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084748
AA Change: V85E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081800
Gene: ENSMUSG00000040183
AA Change: V85E

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 269 2.11e2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 382 410 N/A INTRINSIC
low complexity region 501 521 N/A INTRINSIC
low complexity region 590 608 N/A INTRINSIC
coiled coil region 637 677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084749
AA Change: V85E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081801
Gene: ENSMUSG00000040183
AA Change: V85E

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084750
AA Change: V85E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081802
Gene: ENSMUSG00000040183
AA Change: V85E

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108166
AA Change: V85E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103801
Gene: ENSMUSG00000040183
AA Change: V85E

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 3.74e0 SMART
ANK 140 169 6.12e-5 SMART
ANK 173 202 5.32e-5 SMART
low complexity region 207 227 N/A INTRINSIC
low complexity region 306 318 N/A INTRINSIC
coiled coil region 358 386 N/A INTRINSIC
low complexity region 468 491 N/A INTRINSIC
low complexity region 561 579 N/A INTRINSIC
coiled coil region 608 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149650
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein which is thought to be involved in the Wnt signaling pathway and embryonic axis formation. Similar genes have been found in human, rhesus macaque, and zebrafish. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display sporadic disruption of utricle hair cell polarity but normal cochlear and vestibular hair cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,248,206 M459K probably damaging Het
A1cf A T 19: 31,927,126 K263M probably damaging Het
Adam26a G A 8: 43,570,036 T139M possibly damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap9 C T 5: 3,957,645 Q238* probably null Het
Ap2b1 C A 11: 83,324,604 P125T probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Cblc A T 7: 19,790,474 D280E probably benign Het
Cdk11b T C 4: 155,648,397 probably benign Het
Cela2a G T 4: 141,817,946 F239L probably damaging Het
Cfap57 A T 4: 118,606,631 C342S probably benign Het
Clca4a C A 3: 144,963,755 W345L probably damaging Het
Col6a5 T C 9: 105,931,293 D852G unknown Het
Cyp4a32 T C 4: 115,611,308 V329A possibly damaging Het
Dcaf8 C T 1: 172,175,495 P287S probably damaging Het
Dmxl1 T A 18: 49,934,637 D2654E probably damaging Het
Dpep1 A T 8: 123,200,747 I347F possibly damaging Het
Dtnb T A 12: 3,643,936 Y56* probably null Het
Duox1 T C 2: 122,338,644 Y1182H possibly damaging Het
Dusp10 T A 1: 184,037,225 S129R probably benign Het
Epcam G A 17: 87,642,128 R173Q probably damaging Het
Ephb3 A G 16: 21,220,650 E384G probably damaging Het
Exosc10 A T 4: 148,568,503 D525V probably damaging Het
Fam186a T A 15: 99,942,346 T2006S possibly damaging Het
Fbxw21 T A 9: 109,148,174 T156S possibly damaging Het
Fcrl5 A G 3: 87,457,397 E568G probably damaging Het
Fmn2 C T 1: 174,608,458 probably benign Het
Fut9 A G 4: 25,619,744 F357L possibly damaging Het
Gas2l1 G A 11: 5,064,266 H65Y probably damaging Het
Gjd2 A T 2: 114,013,133 M1K probably null Het
Gm12169 T C 11: 46,526,294 L13P probably damaging Het
Gm884 T A 11: 103,617,071 probably benign Het
Hdgfl3 T C 7: 81,899,684 Y149C probably damaging Het
Hmcn2 T C 2: 31,354,721 V730A probably damaging Het
Inpp4a A T 1: 37,398,799 S223C probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Knl1 T A 2: 119,071,738 W1307R probably benign Het
Kpna3 A G 14: 61,387,477 L139P probably damaging Het
Lama3 T C 18: 12,479,872 probably null Het
Lin54 G A 5: 100,485,249 P192L possibly damaging Het
Lpo T A 11: 87,809,192 probably null Het
Lrrd1 T G 5: 3,850,483 probably null Het
Nbas T A 12: 13,560,977 probably null Het
Nemp1 G A 10: 127,696,248 G341D probably damaging Het
Nrp1 T C 8: 128,425,885 F192L probably damaging Het
Nufip2 T A 11: 77,693,090 V610E probably damaging Het
Nup160 T G 2: 90,700,436 Y479* probably null Het
Oas1d A T 5: 120,919,962 D323V possibly damaging Het
Olfr125 A G 17: 37,835,353 D118G possibly damaging Het
Olfr1338 A G 4: 118,753,600 W315R possibly damaging Het
Olfr140 T C 2: 90,051,784 Y180C probably damaging Het
Olfr147 G A 9: 38,403,254 V127M possibly damaging Het
Olfr204 T A 16: 59,314,706 R234* probably null Het
Olfr25 A T 9: 38,330,507 T307S probably benign Het
Olfr677 C A 7: 105,056,794 H183N probably damaging Het
Pcm1 T A 8: 41,313,359 M1567K possibly damaging Het
Pdxk A G 10: 78,443,896 V215A probably benign Het
Phf12 T A 11: 78,023,601 L74Q probably damaging Het
Plcg1 A G 2: 160,753,743 E537G probably null Het
Plxna2 C T 1: 194,644,370 P204L possibly damaging Het
Ppp3cb T G 14: 20,524,063 M236L probably benign Het
Qrsl1 A T 10: 43,896,030 S55T probably damaging Het
Rbm5 T C 9: 107,743,913 probably null Het
Sipa1l2 A G 8: 125,444,535 S1403P probably damaging Het
Sis C T 3: 72,965,604 C67Y probably damaging Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Speg G A 1: 75,417,863 E1739K probably benign Het
Sprtn C A 8: 124,901,633 H154Q probably damaging Het
St7l A G 3: 104,870,987 T147A probably benign Het
Stab1 G A 14: 31,146,028 Q1630* probably null Het
Stpg2 A G 3: 139,232,199 D173G probably benign Het
Tcf20 G A 15: 82,852,777 T1491I probably benign Het
Themis2 A T 4: 132,789,649 I180N possibly damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn C T 2: 76,745,634 V24972M probably damaging Het
Ttn A G 2: 76,807,996 V13980A probably damaging Het
Usp5 A T 6: 124,823,460 M286K possibly damaging Het
Vmn2r22 G A 6: 123,637,843 R263C possibly damaging Het
Vmn2r71 T G 7: 85,621,227 C534G probably damaging Het
Wdr60 T C 12: 116,255,912 I137V probably benign Het
Wnk2 C T 13: 49,060,726 S1460N possibly damaging Het
Zfp445 G A 9: 122,852,642 P745S probably damaging Het
Zfp957 C T 14: 79,213,996 G121D probably damaging Het
Zscan4f A G 7: 11,401,327 E220G possibly damaging Het
Other mutations in Ankrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02489:Ankrd6 APN 4 32810298 missense probably damaging 1.00
IGL03247:Ankrd6 APN 4 32860441 start codon destroyed possibly damaging 0.76
IGL03382:Ankrd6 APN 4 32808771 missense probably damaging 1.00
R0360:Ankrd6 UTSW 4 32836424 missense probably damaging 1.00
R0711:Ankrd6 UTSW 4 32815326 missense probably damaging 1.00
R1074:Ankrd6 UTSW 4 32822232 missense probably damaging 1.00
R1075:Ankrd6 UTSW 4 32822232 missense probably damaging 1.00
R1498:Ankrd6 UTSW 4 32810289 missense probably benign 0.17
R1823:Ankrd6 UTSW 4 32824427 missense probably damaging 1.00
R2889:Ankrd6 UTSW 4 32818704 missense probably damaging 0.99
R2897:Ankrd6 UTSW 4 32860438 missense probably damaging 0.98
R3815:Ankrd6 UTSW 4 32806206 missense probably benign 0.39
R3836:Ankrd6 UTSW 4 32817531 missense probably damaging 1.00
R4127:Ankrd6 UTSW 4 32822241 missense probably damaging 1.00
R4994:Ankrd6 UTSW 4 32860387 missense probably damaging 0.99
R5250:Ankrd6 UTSW 4 32860335 missense probably damaging 1.00
R5291:Ankrd6 UTSW 4 32823446 missense probably damaging 1.00
R5335:Ankrd6 UTSW 4 32818651 missense probably damaging 1.00
R5948:Ankrd6 UTSW 4 32817075 missense possibly damaging 0.91
R6336:Ankrd6 UTSW 4 32860411 missense probably damaging 1.00
R6345:Ankrd6 UTSW 4 32810266 missense probably damaging 1.00
R6349:Ankrd6 UTSW 4 32822231 missense probably damaging 1.00
R6516:Ankrd6 UTSW 4 32836427 missense probably damaging 1.00
R6902:Ankrd6 UTSW 4 32806419 missense probably damaging 1.00
R6902:Ankrd6 UTSW 4 32806420 missense probably damaging 1.00
R6999:Ankrd6 UTSW 4 32823459 missense probably benign
R7044:Ankrd6 UTSW 4 32815260 missense possibly damaging 0.93
R7307:Ankrd6 UTSW 4 32816949 missense possibly damaging 0.92
R7394:Ankrd6 UTSW 4 32821298 missense probably damaging 0.99
R7496:Ankrd6 UTSW 4 32810299 missense probably damaging 0.99
R7662:Ankrd6 UTSW 4 32818694 missense probably damaging 1.00
R7873:Ankrd6 UTSW 4 32806499 missense possibly damaging 0.91
R8328:Ankrd6 UTSW 4 32810215 missense probably benign 0.27
R8739:Ankrd6 UTSW 4 32806337 missense possibly damaging 0.47
R8937:Ankrd6 UTSW 4 32823452 missense possibly damaging 0.95
R9211:Ankrd6 UTSW 4 32806580 missense probably damaging 1.00
R9295:Ankrd6 UTSW 4 32822160 missense probably damaging 0.98
R9319:Ankrd6 UTSW 4 32806324 missense probably benign 0.02
R9702:Ankrd6 UTSW 4 32810202 missense possibly damaging 0.49
R9741:Ankrd6 UTSW 4 32860339 nonsense probably null
X0064:Ankrd6 UTSW 4 32806435 missense possibly damaging 0.93
Z1176:Ankrd6 UTSW 4 32806229 missense possibly damaging 0.86
Z1176:Ankrd6 UTSW 4 32806326 missense probably benign 0.08
Z1176:Ankrd6 UTSW 4 32824486 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAGGGGTAGCATCCTGACCATTC -3'
(R):5'- TGTCTCCACTAGGCAGCCAGAAAG -3'

Sequencing Primer
(F):5'- TTCCACAGTGAGTCAAGCTGG -3'
(R):5'- AGGCCGACAGCTATTATTGC -3'
Posted On 2014-05-14