Mutagenetix > Incidental Mutations

Incidental Mutation 'R1719:Ankrd6'

191262

Institutional Source

Beutler Lab

Gene Symbol

Ankrd6

Ensembl Gene

ENSMUSG00000040183

Gene Name

ankyrin repeat domain 6

Synonyms

diversin

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1719 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32804035-32950841 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 32828774 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 85 (V85E)

Ref Sequence

ENSEMBL: ENSMUSP00000103801 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035719] [ENSMUST00000084748] [ENSMUST00000084749] [ENSMUST00000084750] [ENSMUST00000108166]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035719
AA Change: V85E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000041300
Gene: ENSMUSG00000040183
AA Change: V85E

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	5.24e-4	SMART
ANK	140	169	3.74e0	SMART
ANK	173	202	6.12e-5	SMART
ANK	206	235	5.32e-5	SMART
ANK	239	268	6.24e2	SMART
low complexity region	365	377	N/A	INTRINSIC
coiled coil region	417	445	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	625	643	N/A	INTRINSIC
coiled coil region	672	712	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000084748
AA Change: V85E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000081800
Gene: ENSMUSG00000040183
AA Change: V85E

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	5.24e-4	SMART
ANK	140	169	3.74e0	SMART
ANK	173	202	6.12e-5	SMART
ANK	206	235	5.32e-5	SMART
ANK	239	269	2.11e2	SMART
low complexity region	330	342	N/A	INTRINSIC
coiled coil region	382	410	N/A	INTRINSIC
low complexity region	501	521	N/A	INTRINSIC
low complexity region	590	608	N/A	INTRINSIC
coiled coil region	637	677	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000084749
AA Change: V85E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000081801
Gene: ENSMUSG00000040183
AA Change: V85E

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	5.24e-4	SMART
ANK	140	169	3.74e0	SMART
ANK	173	202	6.12e-5	SMART
ANK	206	235	5.32e-5	SMART
ANK	239	268	6.24e2	SMART
low complexity region	365	377	N/A	INTRINSIC
coiled coil region	417	445	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	625	643	N/A	INTRINSIC
coiled coil region	672	712	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000084750
AA Change: V85E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000081802
Gene: ENSMUSG00000040183
AA Change: V85E

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	5.24e-4	SMART
ANK	140	169	3.74e0	SMART
ANK	173	202	6.12e-5	SMART
ANK	206	235	5.32e-5	SMART
ANK	239	268	6.24e2	SMART
low complexity region	365	377	N/A	INTRINSIC
coiled coil region	417	445	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	625	643	N/A	INTRINSIC
coiled coil region	672	712	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108166
AA Change: V85E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103801
Gene: ENSMUSG00000040183
AA Change: V85E

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	3.74e0	SMART
ANK	140	169	6.12e-5	SMART
ANK	173	202	5.32e-5	SMART
low complexity region	207	227	N/A	INTRINSIC
low complexity region	306	318	N/A	INTRINSIC
coiled coil region	358	386	N/A	INTRINSIC
low complexity region	468	491	N/A	INTRINSIC
low complexity region	561	579	N/A	INTRINSIC
coiled coil region	608	648	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128496

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149650

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein which is thought to be involved in the Wnt signaling pathway and embryonic axis formation. Similar genes have been found in human, rhesus macaque, and zebrafish. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display sporadic disruption of utricle hair cell polarity but normal cochlear and vestibular hair cell morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,248,206	M459K	probably damaging	Het
A1cf	A	T	19: 31,927,126	K263M	probably damaging	Het
Adam26a	G	A	8: 43,570,036	T139M	possibly damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Akap9	C	T	5: 3,957,645	Q238*	probably null	Het
Ap2b1	C	A	11: 83,324,604	P125T	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Cblc	A	T	7: 19,790,474	D280E	probably benign	Het
Cdk11b	T	C	4: 155,648,397		probably benign	Het
Cela2a	G	T	4: 141,817,946	F239L	probably damaging	Het
Cfap57	A	T	4: 118,606,631	C342S	probably benign	Het
Clca4a	C	A	3: 144,963,755	W345L	probably damaging	Het
Col6a5	T	C	9: 105,931,293	D852G	unknown	Het
Cyp4a32	T	C	4: 115,611,308	V329A	possibly damaging	Het
Dcaf8	C	T	1: 172,175,495	P287S	probably damaging	Het
Dmxl1	T	A	18: 49,934,637	D2654E	probably damaging	Het
Dpep1	A	T	8: 123,200,747	I347F	possibly damaging	Het
Dtnb	T	A	12: 3,643,936	Y56*	probably null	Het
Duox1	T	C	2: 122,338,644	Y1182H	possibly damaging	Het
Dusp10	T	A	1: 184,037,225	S129R	probably benign	Het
Epcam	G	A	17: 87,642,128	R173Q	probably damaging	Het
Ephb3	A	G	16: 21,220,650	E384G	probably damaging	Het
Exosc10	A	T	4: 148,568,503	D525V	probably damaging	Het
Fam186a	T	A	15: 99,942,346	T2006S	possibly damaging	Het
Fbxw21	T	A	9: 109,148,174	T156S	possibly damaging	Het
Fcrl5	A	G	3: 87,457,397	E568G	probably damaging	Het
Fmn2	C	T	1: 174,608,458		probably benign	Het
Fut9	A	G	4: 25,619,744	F357L	possibly damaging	Het
Gas2l1	G	A	11: 5,064,266	H65Y	probably damaging	Het
Gjd2	A	T	2: 114,013,133	M1K	probably null	Het
Gm12169	T	C	11: 46,526,294	L13P	probably damaging	Het
Gm884	T	A	11: 103,617,071		probably benign	Het
Hdgfl3	T	C	7: 81,899,684	Y149C	probably damaging	Het
Hmcn2	T	C	2: 31,354,721	V730A	probably damaging	Het
Inpp4a	A	T	1: 37,398,799	S223C	probably damaging	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Knl1	T	A	2: 119,071,738	W1307R	probably benign	Het
Kpna3	A	G	14: 61,387,477	L139P	probably damaging	Het
Lama3	T	C	18: 12,479,872		probably null	Het
Lin54	G	A	5: 100,485,249	P192L	possibly damaging	Het
Lpo	T	A	11: 87,809,192		probably null	Het
Lrrd1	T	G	5: 3,850,483		probably null	Het
Nbas	T	A	12: 13,560,977		probably null	Het
Nemp1	G	A	10: 127,696,248	G341D	probably damaging	Het
Nrp1	T	C	8: 128,425,885	F192L	probably damaging	Het
Nufip2	T	A	11: 77,693,090	V610E	probably damaging	Het
Nup160	T	G	2: 90,700,436	Y479*	probably null	Het
Oas1d	A	T	5: 120,919,962	D323V	possibly damaging	Het
Olfr125	A	G	17: 37,835,353	D118G	possibly damaging	Het
Olfr1338	A	G	4: 118,753,600	W315R	possibly damaging	Het
Olfr140	T	C	2: 90,051,784	Y180C	probably damaging	Het
Olfr147	G	A	9: 38,403,254	V127M	possibly damaging	Het
Olfr204	T	A	16: 59,314,706	R234*	probably null	Het
Olfr25	A	T	9: 38,330,507	T307S	probably benign	Het
Olfr677	C	A	7: 105,056,794	H183N	probably damaging	Het
Pcm1	T	A	8: 41,313,359	M1567K	possibly damaging	Het
Pdxk	A	G	10: 78,443,896	V215A	probably benign	Het
Phf12	T	A	11: 78,023,601	L74Q	probably damaging	Het
Plcg1	A	G	2: 160,753,743	E537G	probably null	Het
Plxna2	C	T	1: 194,644,370	P204L	possibly damaging	Het
Ppp3cb	T	G	14: 20,524,063	M236L	probably benign	Het
Qrsl1	A	T	10: 43,896,030	S55T	probably damaging	Het
Rbm5	T	C	9: 107,743,913		probably null	Het
Sipa1l2	A	G	8: 125,444,535	S1403P	probably damaging	Het
Sis	C	T	3: 72,965,604	C67Y	probably damaging	Het
Specc1	A	G	11: 62,128,392	I686V	possibly damaging	Het
Speg	G	A	1: 75,417,863	E1739K	probably benign	Het
Sprtn	C	A	8: 124,901,633	H154Q	probably damaging	Het
St7l	A	G	3: 104,870,987	T147A	probably benign	Het
Stab1	G	A	14: 31,146,028	Q1630*	probably null	Het
Stpg2	A	G	3: 139,232,199	D173G	probably benign	Het
Tcf20	G	A	15: 82,852,777	T1491I	probably benign	Het
Themis2	A	T	4: 132,789,649	I180N	possibly damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	C	T	2: 76,745,634	V24972M	probably damaging	Het
Ttn	A	G	2: 76,807,996	V13980A	probably damaging	Het
Usp5	A	T	6: 124,823,460	M286K	possibly damaging	Het
Vmn2r22	G	A	6: 123,637,843	R263C	possibly damaging	Het
Vmn2r71	T	G	7: 85,621,227	C534G	probably damaging	Het
Wdr60	T	C	12: 116,255,912	I137V	probably benign	Het
Wnk2	C	T	13: 49,060,726	S1460N	possibly damaging	Het
Zfp445	G	A	9: 122,852,642	P745S	probably damaging	Het
Zfp957	C	T	14: 79,213,996	G121D	probably damaging	Het
Zscan4f	A	G	7: 11,401,327	E220G	possibly damaging	Het

Other mutations in Ankrd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02489:Ankrd6	APN	4	32810298	missense	probably damaging	1.00
IGL03247:Ankrd6	APN	4	32860441	start codon destroyed	possibly damaging	0.76
IGL03382:Ankrd6	APN	4	32808771	missense	probably damaging	1.00
R0360:Ankrd6	UTSW	4	32836424	missense	probably damaging	1.00
R0711:Ankrd6	UTSW	4	32815326	missense	probably damaging	1.00
R1074:Ankrd6	UTSW	4	32822232	missense	probably damaging	1.00
R1075:Ankrd6	UTSW	4	32822232	missense	probably damaging	1.00
R1498:Ankrd6	UTSW	4	32810289	missense	probably benign	0.17
R1823:Ankrd6	UTSW	4	32824427	missense	probably damaging	1.00
R2889:Ankrd6	UTSW	4	32818704	missense	probably damaging	0.99
R2897:Ankrd6	UTSW	4	32860438	missense	probably damaging	0.98
R3815:Ankrd6	UTSW	4	32806206	missense	probably benign	0.39
R3836:Ankrd6	UTSW	4	32817531	missense	probably damaging	1.00
R4127:Ankrd6	UTSW	4	32822241	missense	probably damaging	1.00
R4994:Ankrd6	UTSW	4	32860387	missense	probably damaging	0.99
R5250:Ankrd6	UTSW	4	32860335	missense	probably damaging	1.00
R5291:Ankrd6	UTSW	4	32823446	missense	probably damaging	1.00
R5335:Ankrd6	UTSW	4	32818651	missense	probably damaging	1.00
R5948:Ankrd6	UTSW	4	32817075	missense	possibly damaging	0.91
R6336:Ankrd6	UTSW	4	32860411	missense	probably damaging	1.00
R6345:Ankrd6	UTSW	4	32810266	missense	probably damaging	1.00
R6349:Ankrd6	UTSW	4	32822231	missense	probably damaging	1.00
R6516:Ankrd6	UTSW	4	32836427	missense	probably damaging	1.00
R6902:Ankrd6	UTSW	4	32806419	missense	probably damaging	1.00
R6902:Ankrd6	UTSW	4	32806420	missense	probably damaging	1.00
R6999:Ankrd6	UTSW	4	32823459	missense	probably benign
R7044:Ankrd6	UTSW	4	32815260	missense	possibly damaging	0.93
R7307:Ankrd6	UTSW	4	32816949	missense	possibly damaging	0.92
R7394:Ankrd6	UTSW	4	32821298	missense	probably damaging	0.99
R7496:Ankrd6	UTSW	4	32810299	missense	probably damaging	0.99
R7662:Ankrd6	UTSW	4	32818694	missense	probably damaging	1.00
R7873:Ankrd6	UTSW	4	32806499	missense	possibly damaging	0.91
R8328:Ankrd6	UTSW	4	32810215	missense	probably benign	0.27
R8739:Ankrd6	UTSW	4	32806337	missense	possibly damaging	0.47
R8937:Ankrd6	UTSW	4	32823452	missense	possibly damaging	0.95
X0064:Ankrd6	UTSW	4	32806435	missense	possibly damaging	0.93
Z1176:Ankrd6	UTSW	4	32806229	missense	possibly damaging	0.86
Z1176:Ankrd6	UTSW	4	32806326	missense	probably benign	0.08
Z1176:Ankrd6	UTSW	4	32824486	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGAGGGGTAGCATCCTGACCATTC -3'
(R):5'- TGTCTCCACTAGGCAGCCAGAAAG -3'

Sequencing Primer
(F):5'- TTCCACAGTGAGTCAAGCTGG -3'
(R):5'- AGGCCGACAGCTATTATTGC -3'

Posted On

2014-05-14