Incidental Mutation 'R1719:Cfap57'
ID 191264
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Name cilia and flagella associated protein 57
Synonyms Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1719 (G1)
Quality Score 194
Status Not validated
Chromosome 4
Chromosomal Location 118554551-118620777 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 118606631 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 342 (C342S)
Ref Sequence ENSEMBL: ENSMUSP00000080592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
AlphaFold Q9D180
Predicted Effect probably benign
Transcript: ENSMUST00000071972
AA Change: C342S

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: C342S

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081921
AA Change: C342S

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: C342S

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,248,206 M459K probably damaging Het
A1cf A T 19: 31,927,126 K263M probably damaging Het
Adam26a G A 8: 43,570,036 T139M possibly damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap9 C T 5: 3,957,645 Q238* probably null Het
Ankrd6 A T 4: 32,828,774 V85E probably damaging Het
Ap2b1 C A 11: 83,324,604 P125T probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Cblc A T 7: 19,790,474 D280E probably benign Het
Cdk11b T C 4: 155,648,397 probably benign Het
Cela2a G T 4: 141,817,946 F239L probably damaging Het
Clca4a C A 3: 144,963,755 W345L probably damaging Het
Col6a5 T C 9: 105,931,293 D852G unknown Het
Cyp4a32 T C 4: 115,611,308 V329A possibly damaging Het
Dcaf8 C T 1: 172,175,495 P287S probably damaging Het
Dmxl1 T A 18: 49,934,637 D2654E probably damaging Het
Dpep1 A T 8: 123,200,747 I347F possibly damaging Het
Dtnb T A 12: 3,643,936 Y56* probably null Het
Duox1 T C 2: 122,338,644 Y1182H possibly damaging Het
Dusp10 T A 1: 184,037,225 S129R probably benign Het
Epcam G A 17: 87,642,128 R173Q probably damaging Het
Ephb3 A G 16: 21,220,650 E384G probably damaging Het
Exosc10 A T 4: 148,568,503 D525V probably damaging Het
Fam186a T A 15: 99,942,346 T2006S possibly damaging Het
Fbxw21 T A 9: 109,148,174 T156S possibly damaging Het
Fcrl5 A G 3: 87,457,397 E568G probably damaging Het
Fmn2 C T 1: 174,608,458 probably benign Het
Fut9 A G 4: 25,619,744 F357L possibly damaging Het
Gas2l1 G A 11: 5,064,266 H65Y probably damaging Het
Gjd2 A T 2: 114,013,133 M1K probably null Het
Gm12169 T C 11: 46,526,294 L13P probably damaging Het
Gm884 T A 11: 103,617,071 probably benign Het
Hdgfl3 T C 7: 81,899,684 Y149C probably damaging Het
Hmcn2 T C 2: 31,354,721 V730A probably damaging Het
Inpp4a A T 1: 37,398,799 S223C probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Knl1 T A 2: 119,071,738 W1307R probably benign Het
Kpna3 A G 14: 61,387,477 L139P probably damaging Het
Lama3 T C 18: 12,479,872 probably null Het
Lin54 G A 5: 100,485,249 P192L possibly damaging Het
Lpo T A 11: 87,809,192 probably null Het
Lrrd1 T G 5: 3,850,483 probably null Het
Nbas T A 12: 13,560,977 probably null Het
Nemp1 G A 10: 127,696,248 G341D probably damaging Het
Nrp1 T C 8: 128,425,885 F192L probably damaging Het
Nufip2 T A 11: 77,693,090 V610E probably damaging Het
Nup160 T G 2: 90,700,436 Y479* probably null Het
Oas1d A T 5: 120,919,962 D323V possibly damaging Het
Olfr125 A G 17: 37,835,353 D118G possibly damaging Het
Olfr1338 A G 4: 118,753,600 W315R possibly damaging Het
Olfr140 T C 2: 90,051,784 Y180C probably damaging Het
Olfr147 G A 9: 38,403,254 V127M possibly damaging Het
Olfr204 T A 16: 59,314,706 R234* probably null Het
Olfr25 A T 9: 38,330,507 T307S probably benign Het
Olfr677 C A 7: 105,056,794 H183N probably damaging Het
Pcm1 T A 8: 41,313,359 M1567K possibly damaging Het
Pdxk A G 10: 78,443,896 V215A probably benign Het
Phf12 T A 11: 78,023,601 L74Q probably damaging Het
Plcg1 A G 2: 160,753,743 E537G probably null Het
Plxna2 C T 1: 194,644,370 P204L possibly damaging Het
Ppp3cb T G 14: 20,524,063 M236L probably benign Het
Qrsl1 A T 10: 43,896,030 S55T probably damaging Het
Rbm5 T C 9: 107,743,913 probably null Het
Sipa1l2 A G 8: 125,444,535 S1403P probably damaging Het
Sis C T 3: 72,965,604 C67Y probably damaging Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Speg G A 1: 75,417,863 E1739K probably benign Het
Sprtn C A 8: 124,901,633 H154Q probably damaging Het
St7l A G 3: 104,870,987 T147A probably benign Het
Stab1 G A 14: 31,146,028 Q1630* probably null Het
Stpg2 A G 3: 139,232,199 D173G probably benign Het
Tcf20 G A 15: 82,852,777 T1491I probably benign Het
Themis2 A T 4: 132,789,649 I180N possibly damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn C T 2: 76,745,634 V24972M probably damaging Het
Ttn A G 2: 76,807,996 V13980A probably damaging Het
Usp5 A T 6: 124,823,460 M286K possibly damaging Het
Vmn2r22 G A 6: 123,637,843 R263C possibly damaging Het
Vmn2r71 T G 7: 85,621,227 C534G probably damaging Het
Wdr60 T C 12: 116,255,912 I137V probably benign Het
Wnk2 C T 13: 49,060,726 S1460N possibly damaging Het
Zfp445 G A 9: 122,852,642 P745S probably damaging Het
Zfp957 C T 14: 79,213,996 G121D probably damaging Het
Zscan4f A G 7: 11,401,327 E220G possibly damaging Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118581001 missense probably benign 0.01
IGL00508:Cfap57 APN 4 118581170 splice site probably null
IGL00857:Cfap57 APN 4 118612923 critical splice donor site probably null
IGL01147:Cfap57 APN 4 118589001 missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118610595 missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118612940 missense probably benign 0.21
IGL01615:Cfap57 APN 4 118600796 missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118613017 missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118579372 missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118569348 critical splice donor site probably null
IGL02800:Cfap57 APN 4 118614750 missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118584739 missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118599019 missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118576645 missense probably benign 0.29
IGL03376:Cfap57 APN 4 118584720 missense probably damaging 0.96
G1Funyon:Cfap57 UTSW 4 118593074 missense possibly damaging 0.94
R0144:Cfap57 UTSW 4 118584705 missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118599012 missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118569431 missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118620402 missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118569727 splice site probably benign
R0730:Cfap57 UTSW 4 118612920 splice site probably null
R0737:Cfap57 UTSW 4 118581102 missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118561872 missense probably benign 0.04
R0880:Cfap57 UTSW 4 118581838 nonsense probably null
R1085:Cfap57 UTSW 4 118595779 missense probably benign 0.20
R1119:Cfap57 UTSW 4 118606676 nonsense probably null
R1217:Cfap57 UTSW 4 118606652 missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118606534 critical splice donor site probably null
R1487:Cfap57 UTSW 4 118614781 missense probably benign 0.01
R1676:Cfap57 UTSW 4 118595940 missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118569646 missense probably null 0.20
R1709:Cfap57 UTSW 4 118571704 missense probably benign 0.00
R1782:Cfap57 UTSW 4 118614975 missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118571724 missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118599894 missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118599927 missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118615010 missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118593132 missense probably benign 0.03
R2177:Cfap57 UTSW 4 118606688 missense probably benign 0.00
R2322:Cfap57 UTSW 4 118610725 missense probably benign
R3905:Cfap57 UTSW 4 118595839 missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118593143 missense probably benign 0.01
R4079:Cfap57 UTSW 4 118598997 missense probably benign 0.34
R4962:Cfap57 UTSW 4 118613065 missense probably benign 0.21
R4970:Cfap57 UTSW 4 118620371 missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118593054 missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118595848 missense probably benign 0.01
R5482:Cfap57 UTSW 4 118569641 missense probably benign
R5522:Cfap57 UTSW 4 118595888 missense probably benign 0.41
R5626:Cfap57 UTSW 4 118614783 missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118569459 missense probably benign
R5712:Cfap57 UTSW 4 118614795 missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118571745 missense probably benign 0.00
R6244:Cfap57 UTSW 4 118579410 missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118569451 nonsense probably null
R6271:Cfap57 UTSW 4 118595759 missense probably benign 0.13
R6330:Cfap57 UTSW 4 118569396 missense probably benign
R6439:Cfap57 UTSW 4 118588975 critical splice donor site probably null
R6639:Cfap57 UTSW 4 118554712 missense probably benign 0.13
R6722:Cfap57 UTSW 4 118584717 missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118613126 missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118620709 unclassified probably benign
R7162:Cfap57 UTSW 4 118614931 missense probably benign
R7174:Cfap57 UTSW 4 118589067 missense probably benign 0.35
R7210:Cfap57 UTSW 4 118576703 nonsense probably null
R7242:Cfap57 UTSW 4 118593096 missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118554800 nonsense probably null
R7359:Cfap57 UTSW 4 118598965 missense probably benign 0.01
R7373:Cfap57 UTSW 4 118614931 missense probably benign
R7394:Cfap57 UTSW 4 118593137 missense probably benign 0.00
R7401:Cfap57 UTSW 4 118614931 missense probably benign
R7412:Cfap57 UTSW 4 118614931 missense probably benign
R7414:Cfap57 UTSW 4 118614931 missense probably benign
R7452:Cfap57 UTSW 4 118595784 missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118589001 missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118614931 missense probably benign
R7642:Cfap57 UTSW 4 118614931 missense probably benign
R7741:Cfap57 UTSW 4 118614931 missense probably benign
R7744:Cfap57 UTSW 4 118614931 missense probably benign
R7745:Cfap57 UTSW 4 118614931 missense probably benign
R7842:Cfap57 UTSW 4 118554755 nonsense probably null
R7936:Cfap57 UTSW 4 118614931 missense probably benign
R7940:Cfap57 UTSW 4 118614931 missense probably benign
R7942:Cfap57 UTSW 4 118614931 missense probably benign
R8074:Cfap57 UTSW 4 118569625 missense possibly damaging 0.66
R8301:Cfap57 UTSW 4 118593074 missense possibly damaging 0.94
R8411:Cfap57 UTSW 4 118614931 missense probably benign
R8447:Cfap57 UTSW 4 118614931 missense probably benign
R8491:Cfap57 UTSW 4 118614931 missense probably benign
R8524:Cfap57 UTSW 4 118614931 missense probably benign
R8670:Cfap57 UTSW 4 118614925 missense possibly damaging 0.91
R8707:Cfap57 UTSW 4 118593006 missense probably benign 0.04
R8790:Cfap57 UTSW 4 118581914 missense possibly damaging 0.59
R8941:Cfap57 UTSW 4 118569602 missense probably damaging 0.99
R9139:Cfap57 UTSW 4 118554851 missense probably benign 0.02
R9212:Cfap57 UTSW 4 118579452 missense possibly damaging 0.95
R9442:Cfap57 UTSW 4 118606534 critical splice donor site probably null
R9525:Cfap57 UTSW 4 118576581 missense probably damaging 1.00
X0022:Cfap57 UTSW 4 118614745 missense probably benign
Z1088:Cfap57 UTSW 4 118581882 missense probably benign 0.22
Z1177:Cfap57 UTSW 4 118598956 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGATTCCGTTCCCTGAGACACCAC -3'
(R):5'- ACCCTTCAGATGCTAGTTGCTGC -3'

Sequencing Primer
(F):5'- GTACCAAGCTTTGCATGGAC -3'
(R):5'- CTAGTTGCTGCAAAAATGAGCAC -3'
Posted On 2014-05-14