Incidental Mutation 'R1719:Cela2a'
ID 191267
Institutional Source Beutler Lab
Gene Symbol Cela2a
Ensembl Gene ENSMUSG00000058579
Gene Name chymotrypsin-like elastase family, member 2A
Synonyms Ela-2, Ela2, Ela2a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock # R1719 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 141814962-141826160 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 141817946 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 239 (F239L)
Ref Sequence ENSEMBL: ENSMUSP00000099539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030747] [ENSMUST00000097805] [ENSMUST00000102481]
AlphaFold P05208
Predicted Effect probably benign
Transcript: ENSMUST00000030747
SMART Domains Protein: ENSMUSP00000030747
Gene: ENSMUSG00000028914

DomainStartEndE-ValueType
CARD 1 91 2.99e-32 SMART
CASc 190 453 4.64e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097805
SMART Domains Protein: ENSMUSP00000095414
Gene: ENSMUSG00000028914

DomainStartEndE-ValueType
CARD 1 91 2.99e-32 SMART
CASc 190 402 6.58e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102481
AA Change: F239L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099539
Gene: ENSMUSG00000058579
AA Change: F239L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 30 264 2.75e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127962
Predicted Effect probably benign
Transcript: ENSMUST00000176781
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine protease enzyme that hydrolyzes elastin. This gene is highly expressed in the pancreatic acinar cells where the encoded preproprotein undergoes processing including signal peptide cleavage to generate an inactive zymogen. The removal of N-terminal activation peptide from the zymogen by trypsin generates active elastase enzyme. This gene is also expressed in the mouse epidermis where it participates in pro-filaggrin processing. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,248,206 M459K probably damaging Het
A1cf A T 19: 31,927,126 K263M probably damaging Het
Adam26a G A 8: 43,570,036 T139M possibly damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap9 C T 5: 3,957,645 Q238* probably null Het
Ankrd6 A T 4: 32,828,774 V85E probably damaging Het
Ap2b1 C A 11: 83,324,604 P125T probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Cblc A T 7: 19,790,474 D280E probably benign Het
Cdk11b T C 4: 155,648,397 probably benign Het
Cfap57 A T 4: 118,606,631 C342S probably benign Het
Clca4a C A 3: 144,963,755 W345L probably damaging Het
Col6a5 T C 9: 105,931,293 D852G unknown Het
Cyp4a32 T C 4: 115,611,308 V329A possibly damaging Het
Dcaf8 C T 1: 172,175,495 P287S probably damaging Het
Dmxl1 T A 18: 49,934,637 D2654E probably damaging Het
Dpep1 A T 8: 123,200,747 I347F possibly damaging Het
Dtnb T A 12: 3,643,936 Y56* probably null Het
Duox1 T C 2: 122,338,644 Y1182H possibly damaging Het
Dusp10 T A 1: 184,037,225 S129R probably benign Het
Epcam G A 17: 87,642,128 R173Q probably damaging Het
Ephb3 A G 16: 21,220,650 E384G probably damaging Het
Exosc10 A T 4: 148,568,503 D525V probably damaging Het
Fam186a T A 15: 99,942,346 T2006S possibly damaging Het
Fbxw21 T A 9: 109,148,174 T156S possibly damaging Het
Fcrl5 A G 3: 87,457,397 E568G probably damaging Het
Fmn2 C T 1: 174,608,458 probably benign Het
Fut9 A G 4: 25,619,744 F357L possibly damaging Het
Gas2l1 G A 11: 5,064,266 H65Y probably damaging Het
Gjd2 A T 2: 114,013,133 M1K probably null Het
Gm12169 T C 11: 46,526,294 L13P probably damaging Het
Gm884 T A 11: 103,617,071 probably benign Het
Hdgfl3 T C 7: 81,899,684 Y149C probably damaging Het
Hmcn2 T C 2: 31,354,721 V730A probably damaging Het
Inpp4a A T 1: 37,398,799 S223C probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Knl1 T A 2: 119,071,738 W1307R probably benign Het
Kpna3 A G 14: 61,387,477 L139P probably damaging Het
Lama3 T C 18: 12,479,872 probably null Het
Lin54 G A 5: 100,485,249 P192L possibly damaging Het
Lpo T A 11: 87,809,192 probably null Het
Lrrd1 T G 5: 3,850,483 probably null Het
Nbas T A 12: 13,560,977 probably null Het
Nemp1 G A 10: 127,696,248 G341D probably damaging Het
Nrp1 T C 8: 128,425,885 F192L probably damaging Het
Nufip2 T A 11: 77,693,090 V610E probably damaging Het
Nup160 T G 2: 90,700,436 Y479* probably null Het
Oas1d A T 5: 120,919,962 D323V possibly damaging Het
Olfr125 A G 17: 37,835,353 D118G possibly damaging Het
Olfr1338 A G 4: 118,753,600 W315R possibly damaging Het
Olfr140 T C 2: 90,051,784 Y180C probably damaging Het
Olfr147 G A 9: 38,403,254 V127M possibly damaging Het
Olfr204 T A 16: 59,314,706 R234* probably null Het
Olfr25 A T 9: 38,330,507 T307S probably benign Het
Olfr677 C A 7: 105,056,794 H183N probably damaging Het
Pcm1 T A 8: 41,313,359 M1567K possibly damaging Het
Pdxk A G 10: 78,443,896 V215A probably benign Het
Phf12 T A 11: 78,023,601 L74Q probably damaging Het
Plcg1 A G 2: 160,753,743 E537G probably null Het
Plxna2 C T 1: 194,644,370 P204L possibly damaging Het
Ppp3cb T G 14: 20,524,063 M236L probably benign Het
Qrsl1 A T 10: 43,896,030 S55T probably damaging Het
Rbm5 T C 9: 107,743,913 probably null Het
Sipa1l2 A G 8: 125,444,535 S1403P probably damaging Het
Sis C T 3: 72,965,604 C67Y probably damaging Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Speg G A 1: 75,417,863 E1739K probably benign Het
Sprtn C A 8: 124,901,633 H154Q probably damaging Het
St7l A G 3: 104,870,987 T147A probably benign Het
Stab1 G A 14: 31,146,028 Q1630* probably null Het
Stpg2 A G 3: 139,232,199 D173G probably benign Het
Tcf20 G A 15: 82,852,777 T1491I probably benign Het
Themis2 A T 4: 132,789,649 I180N possibly damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn C T 2: 76,745,634 V24972M probably damaging Het
Ttn A G 2: 76,807,996 V13980A probably damaging Het
Usp5 A T 6: 124,823,460 M286K possibly damaging Het
Vmn2r22 G A 6: 123,637,843 R263C possibly damaging Het
Vmn2r71 T G 7: 85,621,227 C534G probably damaging Het
Wdr60 T C 12: 116,255,912 I137V probably benign Het
Wnk2 C T 13: 49,060,726 S1460N possibly damaging Het
Zfp445 G A 9: 122,852,642 P745S probably damaging Het
Zfp957 C T 14: 79,213,996 G121D probably damaging Het
Zscan4f A G 7: 11,401,327 E220G possibly damaging Het
Other mutations in Cela2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Cela2a APN 4 141821454 missense probably damaging 1.00
R0317:Cela2a UTSW 4 141821700 critical splice donor site probably null
R1372:Cela2a UTSW 4 141819094 missense probably damaging 1.00
R1619:Cela2a UTSW 4 141825941 critical splice donor site probably null
R2155:Cela2a UTSW 4 141818039 splice site probably null
R2323:Cela2a UTSW 4 141826079 intron probably benign
R4705:Cela2a UTSW 4 141821411 missense probably benign 0.00
R4851:Cela2a UTSW 4 141825591 missense probably benign 0.03
R4880:Cela2a UTSW 4 141822287 missense probably benign 0.01
R5704:Cela2a UTSW 4 141825988 intron probably benign
R5809:Cela2a UTSW 4 141825553 missense probably benign 0.00
R6710:Cela2a UTSW 4 141822243 missense probably damaging 1.00
R7946:Cela2a UTSW 4 141822306 missense possibly damaging 0.74
RF011:Cela2a UTSW 4 141821715 missense probably benign
Z1176:Cela2a UTSW 4 141821391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACAAGAGGACTCTCTGGAACAC -3'
(R):5'- CCACCACCTGTAACAATAAGGCTGG -3'

Sequencing Primer
(F):5'- GAAGATTAACTTAGCCCCATTTGCC -3'
(R):5'- GGCTGGCTTTAGAGGACATT -3'
Posted On 2014-05-14