Mutagenetix > Incidental Mutation

Incidental Mutation 'R1719:Akap9'

191271

Institutional Source

Beutler Lab

Gene Symbol

Akap9

Ensembl Gene

ENSMUSG00000040407

Gene Name

A kinase (PRKA) anchor protein (yotiao) 9

Synonyms

AKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.601) question?

Stock #

R1719 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3928054-4081310 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 3957645 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 238 (Q238*)

Ref Sequence

ENSEMBL: ENSMUSP00000117209 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044492] [ENSMUST00000143365]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000044492
AA Change: Q220*

SMART Domains

Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: Q220*

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	33	44	N/A	INTRINSIC
low complexity region	98	115	N/A	INTRINSIC
Blast:HPT	126	197	6e-21	BLAST
low complexity region	237	249	N/A	INTRINSIC
low complexity region	297	315	N/A	INTRINSIC
coiled coil region	404	593	N/A	INTRINSIC
coiled coil region	622	756	N/A	INTRINSIC
coiled coil region	777	843	N/A	INTRINSIC
coiled coil region	888	958	N/A	INTRINSIC
low complexity region	982	997	N/A	INTRINSIC
coiled coil region	1037	1065	N/A	INTRINSIC
low complexity region	1233	1246	N/A	INTRINSIC
internal_repeat_2	1247	1312	7.75e-5	PROSPERO
internal_repeat_1	1377	1485	2.63e-5	PROSPERO
coiled coil region	1522	1589	N/A	INTRINSIC
coiled coil region	1789	2107	N/A	INTRINSIC
coiled coil region	2132	2318	N/A	INTRINSIC
internal_repeat_1	2322	2445	2.63e-5	PROSPERO
coiled coil region	2455	2494	N/A	INTRINSIC
low complexity region	2587	2598	N/A	INTRINSIC
low complexity region	2627	2640	N/A	INTRINSIC
internal_repeat_2	2934	2997	7.75e-5	PROSPERO
low complexity region	3000	3016	N/A	INTRINSIC
coiled coil region	3109	3307	N/A	INTRINSIC
coiled coil region	3455	3493	N/A	INTRINSIC
coiled coil region	3521	3556	N/A	INTRINSIC
Pfam:PACT_coil_coil	3576	3657	1.2e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132058

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140977

Predicted Effect

probably null
Transcript: ENSMUST00000143365
AA Change: Q238*

SMART Domains

Protein: ENSMUSP00000117209
Gene: ENSMUSG00000040407
AA Change: Q238*

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	33	44	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Blast:HPT	144	215	9e-22	BLAST
low complexity region	255	267	N/A	INTRINSIC
low complexity region	315	333	N/A	INTRINSIC
coiled coil region	422	571	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177448

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,248,206	M459K	probably damaging	Het
A1cf	A	T	19: 31,927,126	K263M	probably damaging	Het
Adam26a	G	A	8: 43,570,036	T139M	possibly damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Ankrd6	A	T	4: 32,828,774	V85E	probably damaging	Het
Ap2b1	C	A	11: 83,324,604	P125T	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Cblc	A	T	7: 19,790,474	D280E	probably benign	Het
Cdk11b	T	C	4: 155,648,397		probably benign	Het
Cela2a	G	T	4: 141,817,946	F239L	probably damaging	Het
Cfap57	A	T	4: 118,606,631	C342S	probably benign	Het
Clca4a	C	A	3: 144,963,755	W345L	probably damaging	Het
Col6a5	T	C	9: 105,931,293	D852G	unknown	Het
Cyp4a32	T	C	4: 115,611,308	V329A	possibly damaging	Het
Dcaf8	C	T	1: 172,175,495	P287S	probably damaging	Het
Dmxl1	T	A	18: 49,934,637	D2654E	probably damaging	Het
Dpep1	A	T	8: 123,200,747	I347F	possibly damaging	Het
Dtnb	T	A	12: 3,643,936	Y56*	probably null	Het
Duox1	T	C	2: 122,338,644	Y1182H	possibly damaging	Het
Dusp10	T	A	1: 184,037,225	S129R	probably benign	Het
Epcam	G	A	17: 87,642,128	R173Q	probably damaging	Het
Ephb3	A	G	16: 21,220,650	E384G	probably damaging	Het
Exosc10	A	T	4: 148,568,503	D525V	probably damaging	Het
Fam186a	T	A	15: 99,942,346	T2006S	possibly damaging	Het
Fbxw21	T	A	9: 109,148,174	T156S	possibly damaging	Het
Fcrl5	A	G	3: 87,457,397	E568G	probably damaging	Het
Fmn2	C	T	1: 174,608,458		probably benign	Het
Fut9	A	G	4: 25,619,744	F357L	possibly damaging	Het
Gas2l1	G	A	11: 5,064,266	H65Y	probably damaging	Het
Gjd2	A	T	2: 114,013,133	M1K	probably null	Het
Gm12169	T	C	11: 46,526,294	L13P	probably damaging	Het
Gm884	T	A	11: 103,617,071		probably benign	Het
Hdgfl3	T	C	7: 81,899,684	Y149C	probably damaging	Het
Hmcn2	T	C	2: 31,354,721	V730A	probably damaging	Het
Inpp4a	A	T	1: 37,398,799	S223C	probably damaging	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Knl1	T	A	2: 119,071,738	W1307R	probably benign	Het
Kpna3	A	G	14: 61,387,477	L139P	probably damaging	Het
Lama3	T	C	18: 12,479,872		probably null	Het
Lin54	G	A	5: 100,485,249	P192L	possibly damaging	Het
Lpo	T	A	11: 87,809,192		probably null	Het
Lrrd1	T	G	5: 3,850,483		probably null	Het
Nbas	T	A	12: 13,560,977		probably null	Het
Nemp1	G	A	10: 127,696,248	G341D	probably damaging	Het
Nrp1	T	C	8: 128,425,885	F192L	probably damaging	Het
Nufip2	T	A	11: 77,693,090	V610E	probably damaging	Het
Nup160	T	G	2: 90,700,436	Y479*	probably null	Het
Oas1d	A	T	5: 120,919,962	D323V	possibly damaging	Het
Olfr125	A	G	17: 37,835,353	D118G	possibly damaging	Het
Olfr1338	A	G	4: 118,753,600	W315R	possibly damaging	Het
Olfr140	T	C	2: 90,051,784	Y180C	probably damaging	Het
Olfr147	G	A	9: 38,403,254	V127M	possibly damaging	Het
Olfr204	T	A	16: 59,314,706	R234*	probably null	Het
Olfr25	A	T	9: 38,330,507	T307S	probably benign	Het
Olfr677	C	A	7: 105,056,794	H183N	probably damaging	Het
Pcm1	T	A	8: 41,313,359	M1567K	possibly damaging	Het
Pdxk	A	G	10: 78,443,896	V215A	probably benign	Het
Phf12	T	A	11: 78,023,601	L74Q	probably damaging	Het
Plcg1	A	G	2: 160,753,743	E537G	probably null	Het
Plxna2	C	T	1: 194,644,370	P204L	possibly damaging	Het
Ppp3cb	T	G	14: 20,524,063	M236L	probably benign	Het
Qrsl1	A	T	10: 43,896,030	S55T	probably damaging	Het
Rbm5	T	C	9: 107,743,913		probably null	Het
Sipa1l2	A	G	8: 125,444,535	S1403P	probably damaging	Het
Sis	C	T	3: 72,965,604	C67Y	probably damaging	Het
Specc1	A	G	11: 62,128,392	I686V	possibly damaging	Het
Speg	G	A	1: 75,417,863	E1739K	probably benign	Het
Sprtn	C	A	8: 124,901,633	H154Q	probably damaging	Het
St7l	A	G	3: 104,870,987	T147A	probably benign	Het
Stab1	G	A	14: 31,146,028	Q1630*	probably null	Het
Stpg2	A	G	3: 139,232,199	D173G	probably benign	Het
Tcf20	G	A	15: 82,852,777	T1491I	probably benign	Het
Themis2	A	T	4: 132,789,649	I180N	possibly damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	C	T	2: 76,745,634	V24972M	probably damaging	Het
Ttn	A	G	2: 76,807,996	V13980A	probably damaging	Het
Usp5	A	T	6: 124,823,460	M286K	possibly damaging	Het
Vmn2r22	G	A	6: 123,637,843	R263C	possibly damaging	Het
Vmn2r71	T	G	7: 85,621,227	C534G	probably damaging	Het
Wdr60	T	C	12: 116,255,912	I137V	probably benign	Het
Wnk2	C	T	13: 49,060,726	S1460N	possibly damaging	Het
Zfp445	G	A	9: 122,852,642	P745S	probably damaging	Het
Zfp957	C	T	14: 79,213,996	G121D	probably damaging	Het
Zscan4f	A	G	7: 11,401,327	E220G	possibly damaging	Het

Other mutations in Akap9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Akap9	APN	5	4046639	missense	probably damaging	0.97
IGL00642:Akap9	APN	5	3960842	missense	probably damaging	0.99
IGL00786:Akap9	APN	5	4070522	missense	probably damaging	1.00
IGL00788:Akap9	APN	5	4060480	missense	probably damaging	1.00
IGL00969:Akap9	APN	5	4001550	missense	probably benign
IGL01014:Akap9	APN	5	3968683	missense	probably benign	0.41
IGL01302:Akap9	APN	5	3970711	missense	probably benign	0.27
IGL01610:Akap9	APN	5	4032839	missense	possibly damaging	0.95
IGL01620:Akap9	APN	5	3960218	missense	probably benign	0.11
IGL01862:Akap9	APN	5	3951705	missense	probably damaging	0.99
IGL01862:Akap9	APN	5	4065856	missense	probably damaging	0.99
IGL02151:Akap9	APN	5	4032728	nonsense	probably null
IGL02635:Akap9	APN	5	4070500	missense	possibly damaging	0.59
IGL02858:Akap9	APN	5	4069130	missense	possibly damaging	0.88
IGL02967:Akap9	APN	5	3976164	missense	probably benign	0.07
IGL03064:Akap9	APN	5	3968755	missense	probably damaging	1.00
IGL03289:Akap9	APN	5	4077261	missense	probably damaging	1.00
Andy	UTSW	5	3961764	nonsense	probably null
blimey	UTSW	5	4070397	nonsense	probably null
hoarder	UTSW	5	4069089	missense	probably benign	0.00
marinarum	UTSW	5	4013875	nonsense	probably null
miser	UTSW	5	4046064	missense	probably benign	0.13
naviculus	UTSW	5	3960865	missense	probably damaging	0.98
thrifty	UTSW	5	3976209	missense	probably damaging	0.99
wee_one	UTSW	5	4043925	missense	probably damaging	1.00
FR4449:Akap9	UTSW	5	3981214	unclassified	probably benign
PIT1430001:Akap9	UTSW	5	4029849	missense	probably damaging	1.00
PIT4366001:Akap9	UTSW	5	4046221	missense	probably benign	0.24
R0088:Akap9	UTSW	5	3961946	missense	probably benign	0.22
R0309:Akap9	UTSW	5	4069038	missense	probably benign	0.01
R0387:Akap9	UTSW	5	3951678	splice site	probably benign
R0440:Akap9	UTSW	5	4064569	missense	probably damaging	0.99
R0441:Akap9	UTSW	5	3961714	missense	probably benign	0.15
R0491:Akap9	UTSW	5	3972851	unclassified	probably benign
R0501:Akap9	UTSW	5	3970685	missense	probably damaging	1.00
R0507:Akap9	UTSW	5	4069043	missense	probably benign	0.41
R0544:Akap9	UTSW	5	4069185	missense	probably benign	0.22
R0581:Akap9	UTSW	5	4050620	missense	probably benign	0.03
R0611:Akap9	UTSW	5	3954870	missense	probably benign	0.00
R0620:Akap9	UTSW	5	4064136	missense	probably damaging	0.98
R0639:Akap9	UTSW	5	4060318	missense	probably damaging	1.00
R0932:Akap9	UTSW	5	4046492	missense	possibly damaging	0.77
R0944:Akap9	UTSW	5	4064742	splice site	probably null
R1101:Akap9	UTSW	5	4046205	missense	probably benign	0.00
R1159:Akap9	UTSW	5	3960865	missense	probably damaging	0.98
R1170:Akap9	UTSW	5	4055671	missense	probably benign
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1453:Akap9	UTSW	5	3975614	splice site	probably null
R1551:Akap9	UTSW	5	4069174	missense	probably benign	0.02
R1608:Akap9	UTSW	5	3961783	missense	probably damaging	1.00
R1652:Akap9	UTSW	5	4077210	missense	probably damaging	1.00
R1659:Akap9	UTSW	5	4064633	missense	probably damaging	1.00
R1713:Akap9	UTSW	5	4039345	critical splice donor site	probably null
R1720:Akap9	UTSW	5	3972791	missense	possibly damaging	0.63
R1757:Akap9	UTSW	5	4001667	missense	probably benign	0.41
R1872:Akap9	UTSW	5	4001406	missense	probably damaging	1.00
R1876:Akap9	UTSW	5	3961809	missense	probably benign	0.28
R1881:Akap9	UTSW	5	4050173	missense	probably benign
R1950:Akap9	UTSW	5	3960677	missense	probably damaging	1.00
R1980:Akap9	UTSW	5	3972771	missense	probably damaging	0.99
R1993:Akap9	UTSW	5	4038520	splice site	probably null
R2008:Akap9	UTSW	5	3960131	missense	possibly damaging	0.47
R2020:Akap9	UTSW	5	3961967	missense	probably damaging	1.00
R2051:Akap9	UTSW	5	3975685	nonsense	probably null
R2061:Akap9	UTSW	5	3961010	missense	probably damaging	1.00
R2109:Akap9	UTSW	5	4044847	missense	possibly damaging	0.47
R2135:Akap9	UTSW	5	4064509	missense	probably damaging	1.00
R2225:Akap9	UTSW	5	4077271	missense	probably damaging	0.96
R2232:Akap9	UTSW	5	4046603	missense	probably damaging	1.00
R2424:Akap9	UTSW	5	4065279	missense	probably damaging	0.97
R2483:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R2879:Akap9	UTSW	5	3976353	intron	probably benign
R3622:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3623:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3624:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3722:Akap9	UTSW	5	4070351	missense	probably damaging	1.00
R3806:Akap9	UTSW	5	3954410	missense	probably benign	0.00
R3919:Akap9	UTSW	5	3961764	nonsense	probably null
R4023:Akap9	UTSW	5	3992077	missense	possibly damaging	0.66
R4093:Akap9	UTSW	5	4043996	missense	probably damaging	0.99
R4434:Akap9	UTSW	5	4032708	missense	probably damaging	0.99
R4529:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4530:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4532:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4533:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4585:Akap9	UTSW	5	3976151	missense	probably benign	0.00
R4586:Akap9	UTSW	5	3976151	missense	probably benign	0.00
R4655:Akap9	UTSW	5	4046403	missense	probably benign	0.14
R4676:Akap9	UTSW	5	4032774	missense	probably damaging	1.00
R4676:Akap9	UTSW	5	4064515	nonsense	probably null
R4724:Akap9	UTSW	5	4055339	missense	probably benign
R4731:Akap9	UTSW	5	3962266	missense	possibly damaging	0.54
R4732:Akap9	UTSW	5	4013901	missense	probably damaging	0.98
R4733:Akap9	UTSW	5	4013901	missense	probably damaging	0.98
R4743:Akap9	UTSW	5	3961013	missense	probably damaging	1.00
R4749:Akap9	UTSW	5	3968737	missense	probably benign	0.41
R4756:Akap9	UTSW	5	4001418	missense	probably damaging	0.99
R4757:Akap9	UTSW	5	4008382	missense	probably damaging	1.00
R4860:Akap9	UTSW	5	4034916	intron	probably benign
R4937:Akap9	UTSW	5	4050145	splice site	probably null
R4960:Akap9	UTSW	5	3957664	missense	probably benign	0.15
R4974:Akap9	UTSW	5	3961466	missense	possibly damaging	0.81
R5101:Akap9	UTSW	5	4001748	missense	probably damaging	0.96
R5160:Akap9	UTSW	5	4030007	missense	probably damaging	1.00
R5200:Akap9	UTSW	5	3960734	missense	probably benign	0.00
R5245:Akap9	UTSW	5	3976209	missense	probably damaging	0.99
R5293:Akap9	UTSW	5	3948687	missense	probably damaging	0.99
R5408:Akap9	UTSW	5	4058458	missense	possibly damaging	0.84
R5507:Akap9	UTSW	5	3968683	missense	probably benign	0.41
R5517:Akap9	UTSW	5	4001665	missense	possibly damaging	0.76
R5579:Akap9	UTSW	5	4064714	missense	possibly damaging	0.93
R5619:Akap9	UTSW	5	3954760	intron	probably benign
R5645:Akap9	UTSW	5	4050590	missense	probably benign	0.09
R5669:Akap9	UTSW	5	4050540	nonsense	probably null
R5686:Akap9	UTSW	5	3971926	missense	probably benign	0.00
R5697:Akap9	UTSW	5	3960170	missense	possibly damaging	0.92
R5821:Akap9	UTSW	5	4046064	missense	probably benign	0.13
R5875:Akap9	UTSW	5	4077285	missense	probably benign	0.01
R5897:Akap9	UTSW	5	4077904	missense	probably benign	0.23
R5999:Akap9	UTSW	5	4043925	missense	probably damaging	1.00
R6025:Akap9	UTSW	5	4032801	missense	probably damaging	1.00
R6078:Akap9	UTSW	5	4067924	critical splice donor site	probably null
R6138:Akap9	UTSW	5	4067924	critical splice donor site	probably null
R6225:Akap9	UTSW	5	3962105	missense	probably damaging	1.00
R6243:Akap9	UTSW	5	4065000	splice site	probably null
R6326:Akap9	UTSW	5	3962061	missense	probably damaging	1.00
R6564:Akap9	UTSW	5	4028491	missense	probably damaging	0.98
R6617:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R6625:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R6632:Akap9	UTSW	5	4013842	splice site	probably null
R6677:Akap9	UTSW	5	4029869	missense	probably benign	0.21
R6717:Akap9	UTSW	5	4064086	missense	probably damaging	1.00
R6893:Akap9	UTSW	5	3961709	missense	probably benign	0.32
R6915:Akap9	UTSW	5	3960551	missense	probably benign	0.03
R6938:Akap9	UTSW	5	4046628	missense	possibly damaging	0.91
R6972:Akap9	UTSW	5	4046699	missense	possibly damaging	0.62
R6973:Akap9	UTSW	5	4046699	missense	possibly damaging	0.62
R6993:Akap9	UTSW	5	4065866	missense	possibly damaging	0.65
R7032:Akap9	UTSW	5	3954896	missense	probably benign
R7164:Akap9	UTSW	5	4060364	missense	probably damaging	0.96
R7170:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7192:Akap9	UTSW	5	4005723	splice site	probably null
R7284:Akap9	UTSW	5	3956246	missense	probably damaging	1.00
R7299:Akap9	UTSW	5	4032696	missense	probably damaging	1.00
R7313:Akap9	UTSW	5	4004933	missense	probably damaging	1.00
R7326:Akap9	UTSW	5	4045930	missense	possibly damaging	0.47
R7343:Akap9	UTSW	5	4046364	missense	probably damaging	0.99
R7455:Akap9	UTSW	5	3972792	missense	probably benign	0.03
R7482:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7489:Akap9	UTSW	5	4004933	missense	probably damaging	1.00
R7525:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7528:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7576:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7577:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7578:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7610:Akap9	UTSW	5	3957677	missense	possibly damaging	0.95
R7658:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7754:Akap9	UTSW	5	4046736	missense	probably benign	0.03
R7818:Akap9	UTSW	5	4013875	nonsense	probably null
R7979:Akap9	UTSW	5	4050381	missense	probably benign
R7991:Akap9	UTSW	5	4064949	splice site	probably null
R8036:Akap9	UTSW	5	4070397	nonsense	probably null
R8054:Akap9	UTSW	5	4038707	critical splice donor site	probably null
R8116:Akap9	UTSW	5	4061183	missense	probably benign	0.04
R8150:Akap9	UTSW	5	3961982	missense	probably damaging	1.00
R8234:Akap9	UTSW	5	4044845	missense	probably benign	0.18
R8348:Akap9	UTSW	5	3948897	critical splice donor site	probably null
R8365:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R8366:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R8448:Akap9	UTSW	5	3948897	critical splice donor site	probably null
R8466:Akap9	UTSW	5	4038659	missense	probably damaging	1.00
R8772:Akap9	UTSW	5	4046255	missense	probably damaging	1.00
R8881:Akap9	UTSW	5	3961279	missense
R8937:Akap9	UTSW	5	4044048	missense	possibly damaging	0.78
R8956:Akap9	UTSW	5	3948805	missense	possibly damaging	0.79
R9000:Akap9	UTSW	5	4055650	missense	probably benign
R9049:Akap9	UTSW	5	4064597	missense
R9074:Akap9	UTSW	5	4077959	missense	probably benign	0.40
R9124:Akap9	UTSW	5	4061284	missense	probably damaging	0.99
R9129:Akap9	UTSW	5	4069089	missense	probably benign	0.00
R9371:Akap9	UTSW	5	3961852	missense	possibly damaging	0.83
R9424:Akap9	UTSW	5	3962223	nonsense	probably null
R9424:Akap9	UTSW	5	3962224	nonsense	probably null
R9509:Akap9	UTSW	5	4046349	missense	probably benign
R9515:Akap9	UTSW	5	4055709	missense	probably damaging	1.00
R9567:Akap9	UTSW	5	4077311	missense	possibly damaging	0.89
R9587:Akap9	UTSW	5	4069149	missense	probably damaging	1.00
R9619:Akap9	UTSW	5	4044833	missense	probably damaging	1.00
R9635:Akap9	UTSW	5	4050545	missense	probably benign	0.20
R9680:Akap9	UTSW	5	3961587	missense	probably benign	0.03
R9691:Akap9	UTSW	5	3960491	missense	probably damaging	1.00
R9726:Akap9	UTSW	5	4003757	missense	probably benign	0.39
U15987:Akap9	UTSW	5	4067924	critical splice donor site	probably null
X0026:Akap9	UTSW	5	4014039	missense	probably damaging	1.00
X0057:Akap9	UTSW	5	3975598	critical splice acceptor site	probably null
Z1176:Akap9	UTSW	5	3962251	missense	probably damaging	0.96
Z1177:Akap9	UTSW	5	4046189	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGACCTACACCTCCCATTCACTTCAC -3'
(R):5'- AGCTTCCTTACCATTTCAAACGCTCTTA -3'

Sequencing Primer
(F):5'- gctttggcagtggtgtttc -3'
(R):5'- TTACCATTTCAAACGCTCTTAATTTC -3'

Posted On

2014-05-14