Mutagenetix > Incidental Mutation

Incidental Mutation 'R1719:Olfr677'

191286

Institutional Source

Beutler Lab

Gene Symbol

Olfr677

Ensembl Gene

ENSMUSG00000073914

Gene Name

olfactory receptor 677

Synonyms

GA_x6K02T2PBJ9-7685262-7686200, MOR32-11

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.151) question?

Stock #

R1719 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105051372-105059006 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 105056794 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 183 (H183N)

Ref Sequence

ENSEMBL: ENSMUSP00000149888 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098161] [ENSMUST00000213204]

AlphaFold

Q8VF06

Predicted Effect

probably damaging
Transcript: ENSMUST00000098161
AA Change: H183N

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000095764
Gene: ENSMUSG00000073914
AA Change: H183N

Domain	Start	End	E-Value	Type
Pfam:7tm_4	33	311	7.6e-120	PFAM
Pfam:7TM_GPCR_Srsx	37	308	4.8e-6	PFAM
Pfam:7tm_1	43	293	1.3e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209491

Predicted Effect

probably damaging
Transcript: ENSMUST00000213204
AA Change: H183N

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,248,206	M459K	probably damaging	Het
A1cf	A	T	19: 31,927,126	K263M	probably damaging	Het
Adam26a	G	A	8: 43,570,036	T139M	possibly damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Akap9	C	T	5: 3,957,645	Q238*	probably null	Het
Ankrd6	A	T	4: 32,828,774	V85E	probably damaging	Het
Ap2b1	C	A	11: 83,324,604	P125T	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Cblc	A	T	7: 19,790,474	D280E	probably benign	Het
Cdk11b	T	C	4: 155,648,397		probably benign	Het
Cela2a	G	T	4: 141,817,946	F239L	probably damaging	Het
Cfap57	A	T	4: 118,606,631	C342S	probably benign	Het
Clca4a	C	A	3: 144,963,755	W345L	probably damaging	Het
Col6a5	T	C	9: 105,931,293	D852G	unknown	Het
Cyp4a32	T	C	4: 115,611,308	V329A	possibly damaging	Het
Dcaf8	C	T	1: 172,175,495	P287S	probably damaging	Het
Dmxl1	T	A	18: 49,934,637	D2654E	probably damaging	Het
Dpep1	A	T	8: 123,200,747	I347F	possibly damaging	Het
Dtnb	T	A	12: 3,643,936	Y56*	probably null	Het
Duox1	T	C	2: 122,338,644	Y1182H	possibly damaging	Het
Dusp10	T	A	1: 184,037,225	S129R	probably benign	Het
Epcam	G	A	17: 87,642,128	R173Q	probably damaging	Het
Ephb3	A	G	16: 21,220,650	E384G	probably damaging	Het
Exosc10	A	T	4: 148,568,503	D525V	probably damaging	Het
Fam186a	T	A	15: 99,942,346	T2006S	possibly damaging	Het
Fbxw21	T	A	9: 109,148,174	T156S	possibly damaging	Het
Fcrl5	A	G	3: 87,457,397	E568G	probably damaging	Het
Fmn2	C	T	1: 174,608,458		probably benign	Het
Fut9	A	G	4: 25,619,744	F357L	possibly damaging	Het
Gas2l1	G	A	11: 5,064,266	H65Y	probably damaging	Het
Gjd2	A	T	2: 114,013,133	M1K	probably null	Het
Gm12169	T	C	11: 46,526,294	L13P	probably damaging	Het
Gm884	T	A	11: 103,617,071		probably benign	Het
Hdgfl3	T	C	7: 81,899,684	Y149C	probably damaging	Het
Hmcn2	T	C	2: 31,354,721	V730A	probably damaging	Het
Inpp4a	A	T	1: 37,398,799	S223C	probably damaging	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Knl1	T	A	2: 119,071,738	W1307R	probably benign	Het
Kpna3	A	G	14: 61,387,477	L139P	probably damaging	Het
Lama3	T	C	18: 12,479,872		probably null	Het
Lin54	G	A	5: 100,485,249	P192L	possibly damaging	Het
Lpo	T	A	11: 87,809,192		probably null	Het
Lrrd1	T	G	5: 3,850,483		probably null	Het
Nbas	T	A	12: 13,560,977		probably null	Het
Nemp1	G	A	10: 127,696,248	G341D	probably damaging	Het
Nrp1	T	C	8: 128,425,885	F192L	probably damaging	Het
Nufip2	T	A	11: 77,693,090	V610E	probably damaging	Het
Nup160	T	G	2: 90,700,436	Y479*	probably null	Het
Oas1d	A	T	5: 120,919,962	D323V	possibly damaging	Het
Olfr125	A	G	17: 37,835,353	D118G	possibly damaging	Het
Olfr1338	A	G	4: 118,753,600	W315R	possibly damaging	Het
Olfr140	T	C	2: 90,051,784	Y180C	probably damaging	Het
Olfr147	G	A	9: 38,403,254	V127M	possibly damaging	Het
Olfr204	T	A	16: 59,314,706	R234*	probably null	Het
Olfr25	A	T	9: 38,330,507	T307S	probably benign	Het
Pcm1	T	A	8: 41,313,359	M1567K	possibly damaging	Het
Pdxk	A	G	10: 78,443,896	V215A	probably benign	Het
Phf12	T	A	11: 78,023,601	L74Q	probably damaging	Het
Plcg1	A	G	2: 160,753,743	E537G	probably null	Het
Plxna2	C	T	1: 194,644,370	P204L	possibly damaging	Het
Ppp3cb	T	G	14: 20,524,063	M236L	probably benign	Het
Qrsl1	A	T	10: 43,896,030	S55T	probably damaging	Het
Rbm5	T	C	9: 107,743,913		probably null	Het
Sipa1l2	A	G	8: 125,444,535	S1403P	probably damaging	Het
Sis	C	T	3: 72,965,604	C67Y	probably damaging	Het
Specc1	A	G	11: 62,128,392	I686V	possibly damaging	Het
Speg	G	A	1: 75,417,863	E1739K	probably benign	Het
Sprtn	C	A	8: 124,901,633	H154Q	probably damaging	Het
St7l	A	G	3: 104,870,987	T147A	probably benign	Het
Stab1	G	A	14: 31,146,028	Q1630*	probably null	Het
Stpg2	A	G	3: 139,232,199	D173G	probably benign	Het
Tcf20	G	A	15: 82,852,777	T1491I	probably benign	Het
Themis2	A	T	4: 132,789,649	I180N	possibly damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	C	T	2: 76,745,634	V24972M	probably damaging	Het
Ttn	A	G	2: 76,807,996	V13980A	probably damaging	Het
Usp5	A	T	6: 124,823,460	M286K	possibly damaging	Het
Vmn2r22	G	A	6: 123,637,843	R263C	possibly damaging	Het
Vmn2r71	T	G	7: 85,621,227	C534G	probably damaging	Het
Wdr60	T	C	12: 116,255,912	I137V	probably benign	Het
Wnk2	C	T	13: 49,060,726	S1460N	possibly damaging	Het
Zfp445	G	A	9: 122,852,642	P745S	probably damaging	Het
Zfp957	C	T	14: 79,213,996	G121D	probably damaging	Het
Zscan4f	A	G	7: 11,401,327	E220G	possibly damaging	Het

Other mutations in Olfr677

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02111:Olfr677	APN	7	105056945	missense	probably benign	0.10
IGL02351:Olfr677	APN	7	105056975	missense	probably damaging	0.98
IGL02358:Olfr677	APN	7	105056975	missense	probably damaging	0.98
IGL02696:Olfr677	APN	7	105056362	missense	probably benign	0.39
R0089:Olfr677	UTSW	7	105057090	nonsense	probably null
R0963:Olfr677	UTSW	7	105056972	missense	probably damaging	0.98
R1157:Olfr677	UTSW	7	105056884	missense	probably benign	0.01
R1998:Olfr677	UTSW	7	105056905	missense	probably benign	0.05
R2039:Olfr677	UTSW	7	105056390	missense	possibly damaging	0.75
R2180:Olfr677	UTSW	7	105056885	missense	probably benign	0.18
R2568:Olfr677	UTSW	7	105056671	missense	probably benign	0.00
R4700:Olfr677	UTSW	7	105056276	missense	possibly damaging	0.81
R4701:Olfr677	UTSW	7	105056879	missense	probably damaging	1.00
R4803:Olfr677	UTSW	7	105056656	missense	probably benign	0.39
R4888:Olfr677	UTSW	7	105056482	missense	possibly damaging	0.95
R5121:Olfr677	UTSW	7	105056482	missense	possibly damaging	0.95
R5190:Olfr677	UTSW	7	105056453	missense	probably damaging	0.96
R5593:Olfr677	UTSW	7	105056504	missense	probably damaging	1.00
R6831:Olfr677	UTSW	7	105056879	missense	possibly damaging	0.95
R6991:Olfr677	UTSW	7	105056564	missense	probably damaging	1.00
R7387:Olfr677	UTSW	7	105057090	nonsense	probably null
R7812:Olfr677	UTSW	7	105056687	missense	possibly damaging	0.59
R7984:Olfr677	UTSW	7	105056432	missense	probably damaging	0.98
R8199:Olfr677	UTSW	7	105056645	missense	probably damaging	0.99
R9532:Olfr677	UTSW	7	105057068	missense	probably damaging	1.00
R9563:Olfr677	UTSW	7	105057074	missense	possibly damaging	0.80
R9646:Olfr677	UTSW	7	105057167	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGGCTGCCTTGCTCAAATGTTC -3'
(R):5'- CCACAAGTGTTTAGCGCCTTCAATC -3'

Sequencing Primer
(F):5'- ACAGGCATGGAAACTGTTTTGC -3'
(R):5'- GCCTTCAATCGGGCATCTTG -3'

Posted On

2014-05-14