Mutagenetix > Incidental Mutation

Incidental Mutation 'R1719:Adam26a'

191290

Institutional Source

Beutler Lab

Gene Symbol

Adam26a

Ensembl Gene

ENSMUSG00000048516

Gene Name

a disintegrin and metallopeptidase domain 26A (testase 3)

Synonyms

Dtgn4, Adam26

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1719 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43568278-43576707 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 43570036 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 139 (T139M)

Ref Sequence

ENSEMBL: ENSMUSP00000058256 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049577]

AlphaFold

Q9R158

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049577
AA Change: T139M

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000058256
Gene: ENSMUSG00000048516
AA Change: T139M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	29	147	2.1e-18	PFAM
Pfam:Reprolysin_5	193	364	4.8e-15	PFAM
Pfam:Reprolysin_4	194	380	2.2e-9	PFAM
Pfam:Reprolysin	195	385	2.7e-48	PFAM
Pfam:Reprolysin_2	215	377	2.4e-16	PFAM
Pfam:Reprolysin_3	219	340	1.2e-15	PFAM
DISIN	401	476	2.98e-41	SMART
ACR	477	613	2.06e-64	SMART
transmembrane domain	671	693	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during the late stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. This gene is located adjacent to two other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,248,206	M459K	probably damaging	Het
A1cf	A	T	19: 31,927,126	K263M	probably damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Akap9	C	T	5: 3,957,645	Q238*	probably null	Het
Ankrd6	A	T	4: 32,828,774	V85E	probably damaging	Het
Ap2b1	C	A	11: 83,324,604	P125T	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Cblc	A	T	7: 19,790,474	D280E	probably benign	Het
Cdk11b	T	C	4: 155,648,397		probably benign	Het
Cela2a	G	T	4: 141,817,946	F239L	probably damaging	Het
Cfap57	A	T	4: 118,606,631	C342S	probably benign	Het
Clca4a	C	A	3: 144,963,755	W345L	probably damaging	Het
Col6a5	T	C	9: 105,931,293	D852G	unknown	Het
Cyp4a32	T	C	4: 115,611,308	V329A	possibly damaging	Het
Dcaf8	C	T	1: 172,175,495	P287S	probably damaging	Het
Dmxl1	T	A	18: 49,934,637	D2654E	probably damaging	Het
Dpep1	A	T	8: 123,200,747	I347F	possibly damaging	Het
Dtnb	T	A	12: 3,643,936	Y56*	probably null	Het
Duox1	T	C	2: 122,338,644	Y1182H	possibly damaging	Het
Dusp10	T	A	1: 184,037,225	S129R	probably benign	Het
Epcam	G	A	17: 87,642,128	R173Q	probably damaging	Het
Ephb3	A	G	16: 21,220,650	E384G	probably damaging	Het
Exosc10	A	T	4: 148,568,503	D525V	probably damaging	Het
Fam186a	T	A	15: 99,942,346	T2006S	possibly damaging	Het
Fbxw21	T	A	9: 109,148,174	T156S	possibly damaging	Het
Fcrl5	A	G	3: 87,457,397	E568G	probably damaging	Het
Fmn2	C	T	1: 174,608,458		probably benign	Het
Fut9	A	G	4: 25,619,744	F357L	possibly damaging	Het
Gas2l1	G	A	11: 5,064,266	H65Y	probably damaging	Het
Gjd2	A	T	2: 114,013,133	M1K	probably null	Het
Gm12169	T	C	11: 46,526,294	L13P	probably damaging	Het
Gm884	T	A	11: 103,617,071		probably benign	Het
Hdgfl3	T	C	7: 81,899,684	Y149C	probably damaging	Het
Hmcn2	T	C	2: 31,354,721	V730A	probably damaging	Het
Inpp4a	A	T	1: 37,398,799	S223C	probably damaging	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Knl1	T	A	2: 119,071,738	W1307R	probably benign	Het
Kpna3	A	G	14: 61,387,477	L139P	probably damaging	Het
Lama3	T	C	18: 12,479,872		probably null	Het
Lin54	G	A	5: 100,485,249	P192L	possibly damaging	Het
Lpo	T	A	11: 87,809,192		probably null	Het
Lrrd1	T	G	5: 3,850,483		probably null	Het
Nbas	T	A	12: 13,560,977		probably null	Het
Nemp1	G	A	10: 127,696,248	G341D	probably damaging	Het
Nrp1	T	C	8: 128,425,885	F192L	probably damaging	Het
Nufip2	T	A	11: 77,693,090	V610E	probably damaging	Het
Nup160	T	G	2: 90,700,436	Y479*	probably null	Het
Oas1d	A	T	5: 120,919,962	D323V	possibly damaging	Het
Olfr125	A	G	17: 37,835,353	D118G	possibly damaging	Het
Olfr1338	A	G	4: 118,753,600	W315R	possibly damaging	Het
Olfr140	T	C	2: 90,051,784	Y180C	probably damaging	Het
Olfr147	G	A	9: 38,403,254	V127M	possibly damaging	Het
Olfr204	T	A	16: 59,314,706	R234*	probably null	Het
Olfr25	A	T	9: 38,330,507	T307S	probably benign	Het
Olfr677	C	A	7: 105,056,794	H183N	probably damaging	Het
Pcm1	T	A	8: 41,313,359	M1567K	possibly damaging	Het
Pdxk	A	G	10: 78,443,896	V215A	probably benign	Het
Phf12	T	A	11: 78,023,601	L74Q	probably damaging	Het
Plcg1	A	G	2: 160,753,743	E537G	probably null	Het
Plxna2	C	T	1: 194,644,370	P204L	possibly damaging	Het
Ppp3cb	T	G	14: 20,524,063	M236L	probably benign	Het
Qrsl1	A	T	10: 43,896,030	S55T	probably damaging	Het
Rbm5	T	C	9: 107,743,913		probably null	Het
Sipa1l2	A	G	8: 125,444,535	S1403P	probably damaging	Het
Sis	C	T	3: 72,965,604	C67Y	probably damaging	Het
Specc1	A	G	11: 62,128,392	I686V	possibly damaging	Het
Speg	G	A	1: 75,417,863	E1739K	probably benign	Het
Sprtn	C	A	8: 124,901,633	H154Q	probably damaging	Het
St7l	A	G	3: 104,870,987	T147A	probably benign	Het
Stab1	G	A	14: 31,146,028	Q1630*	probably null	Het
Stpg2	A	G	3: 139,232,199	D173G	probably benign	Het
Tcf20	G	A	15: 82,852,777	T1491I	probably benign	Het
Themis2	A	T	4: 132,789,649	I180N	possibly damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	C	T	2: 76,745,634	V24972M	probably damaging	Het
Ttn	A	G	2: 76,807,996	V13980A	probably damaging	Het
Usp5	A	T	6: 124,823,460	M286K	possibly damaging	Het
Vmn2r22	G	A	6: 123,637,843	R263C	possibly damaging	Het
Vmn2r71	T	G	7: 85,621,227	C534G	probably damaging	Het
Wdr60	T	C	12: 116,255,912	I137V	probably benign	Het
Wnk2	C	T	13: 49,060,726	S1460N	possibly damaging	Het
Zfp445	G	A	9: 122,852,642	P745S	probably damaging	Het
Zfp957	C	T	14: 79,213,996	G121D	probably damaging	Het
Zscan4f	A	G	7: 11,401,327	E220G	possibly damaging	Het

Other mutations in Adam26a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Adam26a	APN	8	43568859	missense	possibly damaging	0.75
IGL00519:Adam26a	APN	8	43569525	missense	probably damaging	1.00
IGL00658:Adam26a	APN	8	43568903	missense	probably benign	0.00
IGL01514:Adam26a	APN	8	43568448	missense	probably benign
IGL01988:Adam26a	APN	8	43569170	missense	possibly damaging	0.68
IGL02030:Adam26a	APN	8	43568857	missense	probably benign	0.00
IGL02081:Adam26a	APN	8	43570196	missense	probably damaging	0.99
IGL02444:Adam26a	APN	8	43569673	missense	possibly damaging	0.46
IGL02734:Adam26a	APN	8	43569775	missense	probably benign	0.27
IGL03243:Adam26a	APN	8	43568696	missense	probably benign	0.14
IGL03350:Adam26a	APN	8	43569552	nonsense	probably null
R0206:Adam26a	UTSW	8	43570418	missense	possibly damaging	0.81
R0206:Adam26a	UTSW	8	43570418	missense	possibly damaging	0.81
R0324:Adam26a	UTSW	8	43568453	missense	probably benign
R0830:Adam26a	UTSW	8	43568402	missense	probably benign	0.23
R0960:Adam26a	UTSW	8	43568763	missense	probably damaging	1.00
R1259:Adam26a	UTSW	8	43568647	missense	probably benign	0.20
R1259:Adam26a	UTSW	8	43568713	missense	possibly damaging	0.95
R1403:Adam26a	UTSW	8	43569192	nonsense	probably null
R1403:Adam26a	UTSW	8	43569192	nonsense	probably null
R1750:Adam26a	UTSW	8	43570189	missense	possibly damaging	0.90
R1860:Adam26a	UTSW	8	43569541	missense	possibly damaging	0.66
R1861:Adam26a	UTSW	8	43569541	missense	possibly damaging	0.66
R1875:Adam26a	UTSW	8	43569851	missense	probably benign	0.37
R3959:Adam26a	UTSW	8	43569871	missense	probably benign	0.00
R4355:Adam26a	UTSW	8	43570185	missense	probably benign	0.35
R4604:Adam26a	UTSW	8	43570051	missense	probably benign	0.02
R4612:Adam26a	UTSW	8	43568793	missense	probably damaging	0.99
R4909:Adam26a	UTSW	8	43570438	missense	probably benign	0.08
R4937:Adam26a	UTSW	8	43568881	missense	probably damaging	1.00
R5112:Adam26a	UTSW	8	43568856	missense	probably benign	0.04
R5276:Adam26a	UTSW	8	43570420	missense	probably benign	0.30
R5406:Adam26a	UTSW	8	43569104	missense	probably damaging	1.00
R5501:Adam26a	UTSW	8	43569904	nonsense	probably null
R5955:Adam26a	UTSW	8	43569852	missense	probably benign	0.11
R6262:Adam26a	UTSW	8	43569088	missense	possibly damaging	0.91
R6847:Adam26a	UTSW	8	43568428	missense	probably benign	0.23
R6957:Adam26a	UTSW	8	43568903	missense	probably benign	0.00
R7053:Adam26a	UTSW	8	43568799	nonsense	probably null
R7287:Adam26a	UTSW	8	43570343	missense	possibly damaging	0.95
R7393:Adam26a	UTSW	8	43569688	missense	probably benign	0.01
R7477:Adam26a	UTSW	8	43569070	missense	probably damaging	1.00
R7552:Adam26a	UTSW	8	43569970	missense	possibly damaging	0.77
R7670:Adam26a	UTSW	8	43570153	missense	probably benign	0.13
R7918:Adam26a	UTSW	8	43569529	missense	probably damaging	0.98
R8193:Adam26a	UTSW	8	43569236	missense	probably damaging	1.00
R8262:Adam26a	UTSW	8	43569141	nonsense	probably null
R8987:Adam26a	UTSW	8	43569321	missense	probably benign	0.02
R9104:Adam26a	UTSW	8	43570071	missense	probably damaging	0.99
R9350:Adam26a	UTSW	8	43569632	missense	probably benign	0.00
R9487:Adam26a	UTSW	8	43569419	missense	possibly damaging	0.49
R9550:Adam26a	UTSW	8	43569083	missense	probably damaging	1.00
R9762:Adam26a	UTSW	8	43568598	missense	probably benign	0.00
Z1088:Adam26a	UTSW	8	43569698	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCTACAATGTGTGCCATGTCTG -3'
(R):5'- TGACCAAGGTGATCTCCTTGAACAAC -3'

Sequencing Primer
(F):5'- TCCCTGTCTGACTAAAAGGTG -3'
(R):5'- CCTTGAACAACACCATTTTGTG -3'

Posted On

2014-05-14