Incidental Mutation 'R1719:Dpep1'
ID 191293
Institutional Source Beutler Lab
Gene Symbol Dpep1
Ensembl Gene ENSMUSG00000019278
Gene Name dipeptidase 1
Synonyms MBD
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R1719 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 123913069-123928551 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123927486 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 347 (I347F)
Ref Sequence ENSEMBL: ENSMUSP00000019422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000759] [ENSMUST00000019422] [ENSMUST00000127664] [ENSMUST00000212409] [ENSMUST00000212773]
AlphaFold P31428
Predicted Effect probably benign
Transcript: ENSMUST00000000759
SMART Domains Protein: ENSMUSP00000000759
Gene: ENSMUSG00000000743

DomainStartEndE-ValueType
Pfam:Snf7 4 174 6.4e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000019422
AA Change: I347F

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019422
Gene: ENSMUSG00000019278
AA Change: I347F

DomainStartEndE-ValueType
Pfam:Peptidase_M19 25 352 4.1e-122 PFAM
low complexity region 398 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167655
Predicted Effect probably benign
Transcript: ENSMUST00000212409
Predicted Effect probably benign
Transcript: ENSMUST00000212773
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kidney membrane enzyme involved in the metabolism of glutathione and other similar proteins by dipeptide hydrolysis. The encoded protein is known to regulate leukotriene activity by catalyzing the conversion of leukotriene D4 to leukotriene E4. This protein uses zinc as a cofactor and acts as a disulfide-linked homodimer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for disruption of this gene ar phenotypically normal although defects have been noted in the conversion of leukotriene D4 to leukotrience E4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,904,526 (GRCm39) K263M probably damaging Het
Adam26a G A 8: 44,023,073 (GRCm39) T139M possibly damaging Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Akap9 C T 5: 4,007,645 (GRCm39) Q238* probably null Het
Ankrd6 A T 4: 32,828,774 (GRCm39) V85E probably damaging Het
Ap2b1 C A 11: 83,215,430 (GRCm39) P125T probably damaging Het
Arhgef7 C A 8: 11,858,713 (GRCm39) probably null Het
Cblc A T 7: 19,524,399 (GRCm39) D280E probably benign Het
Cdk11b T C 4: 155,732,854 (GRCm39) probably benign Het
Cela2a G T 4: 141,545,257 (GRCm39) F239L probably damaging Het
Cfap57 A T 4: 118,463,828 (GRCm39) C342S probably benign Het
Clca4a C A 3: 144,669,516 (GRCm39) W345L probably damaging Het
Col6a5 T C 9: 105,808,492 (GRCm39) D852G unknown Het
Cyp4a32 T C 4: 115,468,505 (GRCm39) V329A possibly damaging Het
Dcaf8 C T 1: 172,003,062 (GRCm39) P287S probably damaging Het
Dmxl1 T A 18: 50,067,704 (GRCm39) D2654E probably damaging Het
Dtnb T A 12: 3,693,936 (GRCm39) Y56* probably null Het
Duox1 T C 2: 122,169,125 (GRCm39) Y1182H possibly damaging Het
Dusp10 T A 1: 183,769,422 (GRCm39) S129R probably benign Het
Dync2i1 T C 12: 116,219,532 (GRCm39) I137V probably benign Het
Epcam G A 17: 87,949,556 (GRCm39) R173Q probably damaging Het
Ephb3 A G 16: 21,039,400 (GRCm39) E384G probably damaging Het
Exosc10 A T 4: 148,652,960 (GRCm39) D525V probably damaging Het
Fam186a T A 15: 99,840,227 (GRCm39) T2006S possibly damaging Het
Fbxw21 T A 9: 108,977,242 (GRCm39) T156S possibly damaging Het
Fcrl5 A G 3: 87,364,704 (GRCm39) E568G probably damaging Het
Fmn2 C T 1: 174,436,024 (GRCm39) probably benign Het
Fut9 A G 4: 25,619,744 (GRCm39) F357L possibly damaging Het
Garre1 A T 7: 33,947,631 (GRCm39) M459K probably damaging Het
Gas2l1 G A 11: 5,014,266 (GRCm39) H65Y probably damaging Het
Gjd2 A T 2: 113,843,614 (GRCm39) M1K probably null Het
Hdgfl3 T C 7: 81,549,432 (GRCm39) Y149C probably damaging Het
Hmcn2 T C 2: 31,244,733 (GRCm39) V730A probably damaging Het
Inpp4a A T 1: 37,437,880 (GRCm39) S223C probably damaging Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Knl1 T A 2: 118,902,219 (GRCm39) W1307R probably benign Het
Kpna3 A G 14: 61,624,926 (GRCm39) L139P probably damaging Het
Lama3 T C 18: 12,612,929 (GRCm39) probably null Het
Lin54 G A 5: 100,633,108 (GRCm39) P192L possibly damaging Het
Lpo T A 11: 87,700,018 (GRCm39) probably null Het
Lrrc37 T A 11: 103,507,897 (GRCm39) probably benign Het
Lrrd1 T G 5: 3,900,483 (GRCm39) probably null Het
Nbas T A 12: 13,610,978 (GRCm39) probably null Het
Nemp1 G A 10: 127,532,117 (GRCm39) G341D probably damaging Het
Nrp1 T C 8: 129,152,366 (GRCm39) F192L probably damaging Het
Nufip2 T A 11: 77,583,916 (GRCm39) V610E probably damaging Het
Nup160 T G 2: 90,530,780 (GRCm39) Y479* probably null Het
Oas1d A T 5: 121,058,025 (GRCm39) D323V possibly damaging Het
Or10ak14 A G 4: 118,610,797 (GRCm39) W315R possibly damaging Het
Or14j1 A G 17: 38,146,244 (GRCm39) D118G possibly damaging Het
Or4c3d T C 2: 89,882,128 (GRCm39) Y180C probably damaging Het
Or52e4 C A 7: 104,706,001 (GRCm39) H183N probably damaging Het
Or5ac22 T A 16: 59,135,069 (GRCm39) R234* probably null Het
Or8b3 G A 9: 38,314,550 (GRCm39) V127M possibly damaging Het
Or8c9 A T 9: 38,241,803 (GRCm39) T307S probably benign Het
Pcm1 T A 8: 41,766,396 (GRCm39) M1567K possibly damaging Het
Pdxk A G 10: 78,279,730 (GRCm39) V215A probably benign Het
Phf12 T A 11: 77,914,427 (GRCm39) L74Q probably damaging Het
Plcg1 A G 2: 160,595,663 (GRCm39) E537G probably null Het
Plxna2 C T 1: 194,326,678 (GRCm39) P204L possibly damaging Het
Ppp3cb T G 14: 20,574,131 (GRCm39) M236L probably benign Het
Qrsl1 A T 10: 43,772,026 (GRCm39) S55T probably damaging Het
Rbm5 T C 9: 107,621,112 (GRCm39) probably null Het
Sipa1l2 A G 8: 126,171,274 (GRCm39) S1403P probably damaging Het
Sis C T 3: 72,872,937 (GRCm39) C67Y probably damaging Het
Specc1 A G 11: 62,019,218 (GRCm39) I686V possibly damaging Het
Speg G A 1: 75,394,507 (GRCm39) E1739K probably benign Het
Sprtn C A 8: 125,628,372 (GRCm39) H154Q probably damaging Het
St7l A G 3: 104,778,303 (GRCm39) T147A probably benign Het
Stab1 G A 14: 30,867,985 (GRCm39) Q1630* probably null Het
Stpg2 A G 3: 138,937,960 (GRCm39) D173G probably benign Het
Tcf20 G A 15: 82,736,978 (GRCm39) T1491I probably benign Het
Themis2 A T 4: 132,516,960 (GRCm39) I180N possibly damaging Het
Timd5 T C 11: 46,417,121 (GRCm39) L13P probably damaging Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Ttn A G 2: 76,638,340 (GRCm39) V13980A probably damaging Het
Ttn C T 2: 76,575,978 (GRCm39) V24972M probably damaging Het
Usp5 A T 6: 124,800,423 (GRCm39) M286K possibly damaging Het
Vmn2r22 G A 6: 123,614,802 (GRCm39) R263C possibly damaging Het
Vmn2r71 T G 7: 85,270,435 (GRCm39) C534G probably damaging Het
Wnk2 C T 13: 49,214,202 (GRCm39) S1460N possibly damaging Het
Zfp445 G A 9: 122,681,707 (GRCm39) P745S probably damaging Het
Zfp957 C T 14: 79,451,436 (GRCm39) G121D probably damaging Het
Zscan4f A G 7: 11,135,254 (GRCm39) E220G possibly damaging Het
Other mutations in Dpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Dpep1 APN 8 123,926,354 (GRCm39) splice site probably benign
IGL02354:Dpep1 APN 8 123,926,957 (GRCm39) missense probably benign
IGL02361:Dpep1 APN 8 123,926,957 (GRCm39) missense probably benign
IGL02527:Dpep1 APN 8 123,925,487 (GRCm39) missense probably damaging 1.00
IGL02723:Dpep1 APN 8 123,920,888 (GRCm39) missense possibly damaging 0.95
R0190:Dpep1 UTSW 8 123,927,447 (GRCm39) missense probably benign 0.21
R1348:Dpep1 UTSW 8 123,925,899 (GRCm39) missense probably benign 0.02
R2060:Dpep1 UTSW 8 123,927,130 (GRCm39) missense probably damaging 0.99
R2081:Dpep1 UTSW 8 123,926,117 (GRCm39) missense probably damaging 0.97
R2279:Dpep1 UTSW 8 123,920,883 (GRCm39) missense probably benign 0.04
R3931:Dpep1 UTSW 8 123,925,518 (GRCm39) missense possibly damaging 0.73
R4027:Dpep1 UTSW 8 123,920,892 (GRCm39) missense probably benign 0.12
R4836:Dpep1 UTSW 8 123,927,106 (GRCm39) missense probably damaging 1.00
R5007:Dpep1 UTSW 8 123,926,117 (GRCm39) missense probably damaging 0.97
R5149:Dpep1 UTSW 8 123,927,177 (GRCm39) missense probably benign 0.01
R5268:Dpep1 UTSW 8 123,920,828 (GRCm39) missense probably benign 0.12
R5774:Dpep1 UTSW 8 123,926,721 (GRCm39) missense probably damaging 1.00
R6041:Dpep1 UTSW 8 123,927,394 (GRCm39) missense probably damaging 0.99
R6335:Dpep1 UTSW 8 123,927,391 (GRCm39) missense probably damaging 1.00
R7705:Dpep1 UTSW 8 123,927,460 (GRCm39) missense possibly damaging 0.94
R7993:Dpep1 UTSW 8 123,927,460 (GRCm39) missense possibly damaging 0.94
R8130:Dpep1 UTSW 8 123,926,965 (GRCm39) missense probably damaging 1.00
R8810:Dpep1 UTSW 8 123,926,764 (GRCm39) missense probably benign 0.02
T0975:Dpep1 UTSW 8 123,927,727 (GRCm39) missense probably damaging 0.99
X0005:Dpep1 UTSW 8 123,927,727 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACATTTTGCTGCAAGGCTGCTC -3'
(R):5'- AGGTTCCGGTCCTTTGGATGTCAC -3'

Sequencing Primer
(F):5'- CTGCAAGGCTGCTCTTTGG -3'
(R):5'- CTTGAGAGTAGCCATAGTATGTCC -3'
Posted On 2014-05-14