Incidental Mutation 'R1719:Or8b3'
ID 191298
Institutional Source Beutler Lab
Gene Symbol Or8b3
Ensembl Gene ENSMUSG00000049098
Gene Name olfactory receptor family 8 subfamily B member 3
Synonyms MOR164-1, M3, GA_x6K02T2PVTD-32098059-32099003, Olfr147
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R1719 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 38313007-38315125 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 38314550 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 127 (V127M)
Ref Sequence ENSEMBL: ENSMUSP00000051933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056364] [ENSMUST00000214648]
AlphaFold Q60886
Predicted Effect possibly damaging
Transcript: ENSMUST00000056364
AA Change: V127M

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051933
Gene: ENSMUSG00000049098
AA Change: V127M

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 1.2e-48 PFAM
Pfam:7tm_1 44 292 2.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214648
AA Change: V124M

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,904,526 (GRCm39) K263M probably damaging Het
Adam26a G A 8: 44,023,073 (GRCm39) T139M possibly damaging Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Akap9 C T 5: 4,007,645 (GRCm39) Q238* probably null Het
Ankrd6 A T 4: 32,828,774 (GRCm39) V85E probably damaging Het
Ap2b1 C A 11: 83,215,430 (GRCm39) P125T probably damaging Het
Arhgef7 C A 8: 11,858,713 (GRCm39) probably null Het
Cblc A T 7: 19,524,399 (GRCm39) D280E probably benign Het
Cdk11b T C 4: 155,732,854 (GRCm39) probably benign Het
Cela2a G T 4: 141,545,257 (GRCm39) F239L probably damaging Het
Cfap57 A T 4: 118,463,828 (GRCm39) C342S probably benign Het
Clca4a C A 3: 144,669,516 (GRCm39) W345L probably damaging Het
Col6a5 T C 9: 105,808,492 (GRCm39) D852G unknown Het
Cyp4a32 T C 4: 115,468,505 (GRCm39) V329A possibly damaging Het
Dcaf8 C T 1: 172,003,062 (GRCm39) P287S probably damaging Het
Dmxl1 T A 18: 50,067,704 (GRCm39) D2654E probably damaging Het
Dpep1 A T 8: 123,927,486 (GRCm39) I347F possibly damaging Het
Dtnb T A 12: 3,693,936 (GRCm39) Y56* probably null Het
Duox1 T C 2: 122,169,125 (GRCm39) Y1182H possibly damaging Het
Dusp10 T A 1: 183,769,422 (GRCm39) S129R probably benign Het
Dync2i1 T C 12: 116,219,532 (GRCm39) I137V probably benign Het
Epcam G A 17: 87,949,556 (GRCm39) R173Q probably damaging Het
Ephb3 A G 16: 21,039,400 (GRCm39) E384G probably damaging Het
Exosc10 A T 4: 148,652,960 (GRCm39) D525V probably damaging Het
Fam186a T A 15: 99,840,227 (GRCm39) T2006S possibly damaging Het
Fbxw21 T A 9: 108,977,242 (GRCm39) T156S possibly damaging Het
Fcrl5 A G 3: 87,364,704 (GRCm39) E568G probably damaging Het
Fmn2 C T 1: 174,436,024 (GRCm39) probably benign Het
Fut9 A G 4: 25,619,744 (GRCm39) F357L possibly damaging Het
Garre1 A T 7: 33,947,631 (GRCm39) M459K probably damaging Het
Gas2l1 G A 11: 5,014,266 (GRCm39) H65Y probably damaging Het
Gjd2 A T 2: 113,843,614 (GRCm39) M1K probably null Het
Hdgfl3 T C 7: 81,549,432 (GRCm39) Y149C probably damaging Het
Hmcn2 T C 2: 31,244,733 (GRCm39) V730A probably damaging Het
Inpp4a A T 1: 37,437,880 (GRCm39) S223C probably damaging Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Knl1 T A 2: 118,902,219 (GRCm39) W1307R probably benign Het
Kpna3 A G 14: 61,624,926 (GRCm39) L139P probably damaging Het
Lama3 T C 18: 12,612,929 (GRCm39) probably null Het
Lin54 G A 5: 100,633,108 (GRCm39) P192L possibly damaging Het
Lpo T A 11: 87,700,018 (GRCm39) probably null Het
Lrrc37 T A 11: 103,507,897 (GRCm39) probably benign Het
Lrrd1 T G 5: 3,900,483 (GRCm39) probably null Het
Nbas T A 12: 13,610,978 (GRCm39) probably null Het
Nemp1 G A 10: 127,532,117 (GRCm39) G341D probably damaging Het
Nrp1 T C 8: 129,152,366 (GRCm39) F192L probably damaging Het
Nufip2 T A 11: 77,583,916 (GRCm39) V610E probably damaging Het
Nup160 T G 2: 90,530,780 (GRCm39) Y479* probably null Het
Oas1d A T 5: 121,058,025 (GRCm39) D323V possibly damaging Het
Or10ak14 A G 4: 118,610,797 (GRCm39) W315R possibly damaging Het
Or14j1 A G 17: 38,146,244 (GRCm39) D118G possibly damaging Het
Or4c3d T C 2: 89,882,128 (GRCm39) Y180C probably damaging Het
Or52e4 C A 7: 104,706,001 (GRCm39) H183N probably damaging Het
Or5ac22 T A 16: 59,135,069 (GRCm39) R234* probably null Het
Or8c9 A T 9: 38,241,803 (GRCm39) T307S probably benign Het
Pcm1 T A 8: 41,766,396 (GRCm39) M1567K possibly damaging Het
Pdxk A G 10: 78,279,730 (GRCm39) V215A probably benign Het
Phf12 T A 11: 77,914,427 (GRCm39) L74Q probably damaging Het
Plcg1 A G 2: 160,595,663 (GRCm39) E537G probably null Het
Plxna2 C T 1: 194,326,678 (GRCm39) P204L possibly damaging Het
Ppp3cb T G 14: 20,574,131 (GRCm39) M236L probably benign Het
Qrsl1 A T 10: 43,772,026 (GRCm39) S55T probably damaging Het
Rbm5 T C 9: 107,621,112 (GRCm39) probably null Het
Sipa1l2 A G 8: 126,171,274 (GRCm39) S1403P probably damaging Het
Sis C T 3: 72,872,937 (GRCm39) C67Y probably damaging Het
Specc1 A G 11: 62,019,218 (GRCm39) I686V possibly damaging Het
Speg G A 1: 75,394,507 (GRCm39) E1739K probably benign Het
Sprtn C A 8: 125,628,372 (GRCm39) H154Q probably damaging Het
St7l A G 3: 104,778,303 (GRCm39) T147A probably benign Het
Stab1 G A 14: 30,867,985 (GRCm39) Q1630* probably null Het
Stpg2 A G 3: 138,937,960 (GRCm39) D173G probably benign Het
Tcf20 G A 15: 82,736,978 (GRCm39) T1491I probably benign Het
Themis2 A T 4: 132,516,960 (GRCm39) I180N possibly damaging Het
Timd5 T C 11: 46,417,121 (GRCm39) L13P probably damaging Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Ttn A G 2: 76,638,340 (GRCm39) V13980A probably damaging Het
Ttn C T 2: 76,575,978 (GRCm39) V24972M probably damaging Het
Usp5 A T 6: 124,800,423 (GRCm39) M286K possibly damaging Het
Vmn2r22 G A 6: 123,614,802 (GRCm39) R263C possibly damaging Het
Vmn2r71 T G 7: 85,270,435 (GRCm39) C534G probably damaging Het
Wnk2 C T 13: 49,214,202 (GRCm39) S1460N possibly damaging Het
Zfp445 G A 9: 122,681,707 (GRCm39) P745S probably damaging Het
Zfp957 C T 14: 79,451,436 (GRCm39) G121D probably damaging Het
Zscan4f A G 7: 11,135,254 (GRCm39) E220G possibly damaging Het
Other mutations in Or8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Or8b3 APN 9 38,314,317 (GRCm39) missense possibly damaging 0.67
IGL02109:Or8b3 APN 9 38,314,382 (GRCm39) missense possibly damaging 0.91
IGL02805:Or8b3 APN 9 38,315,132 (GRCm39) utr 3 prime probably benign
IGL02875:Or8b3 APN 9 38,314,472 (GRCm39) missense probably damaging 0.99
R1133:Or8b3 UTSW 9 38,315,027 (GRCm39) missense probably benign 0.00
R1446:Or8b3 UTSW 9 38,314,601 (GRCm39) missense possibly damaging 0.73
R1591:Or8b3 UTSW 9 38,314,232 (GRCm39) missense probably damaging 1.00
R1895:Or8b3 UTSW 9 38,314,182 (GRCm39) start codon destroyed probably null 0.88
R1946:Or8b3 UTSW 9 38,314,182 (GRCm39) start codon destroyed probably null 0.88
R1981:Or8b3 UTSW 9 38,315,031 (GRCm39) missense probably damaging 0.99
R2033:Or8b3 UTSW 9 38,314,669 (GRCm39) missense probably damaging 0.99
R4856:Or8b3 UTSW 9 38,314,764 (GRCm39) missense probably damaging 1.00
R5322:Or8b3 UTSW 9 38,314,862 (GRCm39) missense probably damaging 1.00
R6017:Or8b3 UTSW 9 38,314,916 (GRCm39) missense probably benign 0.01
R6037:Or8b3 UTSW 9 38,314,601 (GRCm39) missense probably benign 0.07
R6037:Or8b3 UTSW 9 38,314,601 (GRCm39) missense probably benign 0.07
R7032:Or8b3 UTSW 9 38,314,965 (GRCm39) missense possibly damaging 0.53
R7042:Or8b3 UTSW 9 38,314,196 (GRCm39) missense probably damaging 0.98
R7351:Or8b3 UTSW 9 38,314,739 (GRCm39) missense probably damaging 1.00
R7460:Or8b3 UTSW 9 38,314,649 (GRCm39) missense possibly damaging 0.95
R7820:Or8b3 UTSW 9 38,314,862 (GRCm39) missense probably damaging 1.00
R8161:Or8b3 UTSW 9 38,314,803 (GRCm39) missense probably damaging 0.97
R8196:Or8b3 UTSW 9 38,314,904 (GRCm39) missense probably damaging 1.00
R9103:Or8b3 UTSW 9 38,314,518 (GRCm39) missense probably damaging 1.00
R9213:Or8b3 UTSW 9 38,315,047 (GRCm39) nonsense probably null
R9717:Or8b3 UTSW 9 38,314,841 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTGATCATCCTGATTGGCCTC -3'
(R):5'- CATGATGTGAGAGCTACAGGTGCTG -3'

Sequencing Primer
(F):5'- TGATTGGCCTCAATCCTCAC -3'
(R):5'- CAACCTCATTGACATAGGTACTGG -3'
Posted On 2014-05-14