Incidental Mutation 'R1719:Ap2b1'
ID 191313
Institutional Source Beutler Lab
Gene Symbol Ap2b1
Ensembl Gene ENSMUSG00000035152
Gene Name adaptor-related protein complex 2, beta 1 subunit
Synonyms 1300012O03Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1719 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 83189850-83295861 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 83215430 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 125 (P125T)
Ref Sequence ENSEMBL: ENSMUSP00000134798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523] [ENSMUST00000176944]
AlphaFold Q9DBG3
Predicted Effect probably damaging
Transcript: ENSMUST00000018875
AA Change: P125T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: P125T

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 2.6e-173 PFAM
Pfam:HEAT_2 88 157 3.7e-8 PFAM
Pfam:Cnd1 99 268 2.1e-40 PFAM
Pfam:HEAT_2 124 219 1.4e-9 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 950 9.93e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065692
AA Change: P125T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: P125T

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4.2e-173 PFAM
Pfam:HEAT_2 88 157 2.7e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Alpha_adaptinC2 707 817 2.94e-18 SMART
B2-adapt-app_C 826 936 9.93e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132178
Predicted Effect probably damaging
Transcript: ENSMUST00000176430
AA Change: P125T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: P125T

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4e-173 PFAM
Pfam:HEAT_2 88 157 2.8e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 936 7.22e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176523
SMART Domains Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 95 1.1e-26 PFAM
Pfam:Cnd1 69 230 1.5e-26 PFAM
Pfam:HEAT_2 85 182 5.1e-9 PFAM
Pfam:Adaptin_N 90 496 4e-125 PFAM
low complexity region 587 605 N/A INTRINSIC
low complexity region 616 637 N/A INTRINSIC
Alpha_adaptinC2 683 793 2.94e-18 SMART
B2-adapt-app_C 802 912 9.93e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176944
AA Change: P125T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134798
Gene: ENSMUSG00000035152
AA Change: P125T

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 199 3.4e-67 PFAM
Pfam:DNA_alkylation 18 196 4.6e-8 PFAM
Pfam:HEAT_2 88 185 3.1e-13 PFAM
Pfam:Cnd1 99 198 4.2e-27 PFAM
Pfam:HEAT 122 151 1.4e-5 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,904,526 (GRCm39) K263M probably damaging Het
Adam26a G A 8: 44,023,073 (GRCm39) T139M possibly damaging Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Akap9 C T 5: 4,007,645 (GRCm39) Q238* probably null Het
Ankrd6 A T 4: 32,828,774 (GRCm39) V85E probably damaging Het
Arhgef7 C A 8: 11,858,713 (GRCm39) probably null Het
Cblc A T 7: 19,524,399 (GRCm39) D280E probably benign Het
Cdk11b T C 4: 155,732,854 (GRCm39) probably benign Het
Cela2a G T 4: 141,545,257 (GRCm39) F239L probably damaging Het
Cfap57 A T 4: 118,463,828 (GRCm39) C342S probably benign Het
Clca4a C A 3: 144,669,516 (GRCm39) W345L probably damaging Het
Col6a5 T C 9: 105,808,492 (GRCm39) D852G unknown Het
Cyp4a32 T C 4: 115,468,505 (GRCm39) V329A possibly damaging Het
Dcaf8 C T 1: 172,003,062 (GRCm39) P287S probably damaging Het
Dmxl1 T A 18: 50,067,704 (GRCm39) D2654E probably damaging Het
Dpep1 A T 8: 123,927,486 (GRCm39) I347F possibly damaging Het
Dtnb T A 12: 3,693,936 (GRCm39) Y56* probably null Het
Duox1 T C 2: 122,169,125 (GRCm39) Y1182H possibly damaging Het
Dusp10 T A 1: 183,769,422 (GRCm39) S129R probably benign Het
Dync2i1 T C 12: 116,219,532 (GRCm39) I137V probably benign Het
Epcam G A 17: 87,949,556 (GRCm39) R173Q probably damaging Het
Ephb3 A G 16: 21,039,400 (GRCm39) E384G probably damaging Het
Exosc10 A T 4: 148,652,960 (GRCm39) D525V probably damaging Het
Fam186a T A 15: 99,840,227 (GRCm39) T2006S possibly damaging Het
Fbxw21 T A 9: 108,977,242 (GRCm39) T156S possibly damaging Het
Fcrl5 A G 3: 87,364,704 (GRCm39) E568G probably damaging Het
Fmn2 C T 1: 174,436,024 (GRCm39) probably benign Het
Fut9 A G 4: 25,619,744 (GRCm39) F357L possibly damaging Het
Garre1 A T 7: 33,947,631 (GRCm39) M459K probably damaging Het
Gas2l1 G A 11: 5,014,266 (GRCm39) H65Y probably damaging Het
Gjd2 A T 2: 113,843,614 (GRCm39) M1K probably null Het
Hdgfl3 T C 7: 81,549,432 (GRCm39) Y149C probably damaging Het
Hmcn2 T C 2: 31,244,733 (GRCm39) V730A probably damaging Het
Inpp4a A T 1: 37,437,880 (GRCm39) S223C probably damaging Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Knl1 T A 2: 118,902,219 (GRCm39) W1307R probably benign Het
Kpna3 A G 14: 61,624,926 (GRCm39) L139P probably damaging Het
Lama3 T C 18: 12,612,929 (GRCm39) probably null Het
Lin54 G A 5: 100,633,108 (GRCm39) P192L possibly damaging Het
Lpo T A 11: 87,700,018 (GRCm39) probably null Het
Lrrc37 T A 11: 103,507,897 (GRCm39) probably benign Het
Lrrd1 T G 5: 3,900,483 (GRCm39) probably null Het
Nbas T A 12: 13,610,978 (GRCm39) probably null Het
Nemp1 G A 10: 127,532,117 (GRCm39) G341D probably damaging Het
Nrp1 T C 8: 129,152,366 (GRCm39) F192L probably damaging Het
Nufip2 T A 11: 77,583,916 (GRCm39) V610E probably damaging Het
Nup160 T G 2: 90,530,780 (GRCm39) Y479* probably null Het
Oas1d A T 5: 121,058,025 (GRCm39) D323V possibly damaging Het
Or10ak14 A G 4: 118,610,797 (GRCm39) W315R possibly damaging Het
Or14j1 A G 17: 38,146,244 (GRCm39) D118G possibly damaging Het
Or4c3d T C 2: 89,882,128 (GRCm39) Y180C probably damaging Het
Or52e4 C A 7: 104,706,001 (GRCm39) H183N probably damaging Het
Or5ac22 T A 16: 59,135,069 (GRCm39) R234* probably null Het
Or8b3 G A 9: 38,314,550 (GRCm39) V127M possibly damaging Het
Or8c9 A T 9: 38,241,803 (GRCm39) T307S probably benign Het
Pcm1 T A 8: 41,766,396 (GRCm39) M1567K possibly damaging Het
Pdxk A G 10: 78,279,730 (GRCm39) V215A probably benign Het
Phf12 T A 11: 77,914,427 (GRCm39) L74Q probably damaging Het
Plcg1 A G 2: 160,595,663 (GRCm39) E537G probably null Het
Plxna2 C T 1: 194,326,678 (GRCm39) P204L possibly damaging Het
Ppp3cb T G 14: 20,574,131 (GRCm39) M236L probably benign Het
Qrsl1 A T 10: 43,772,026 (GRCm39) S55T probably damaging Het
Rbm5 T C 9: 107,621,112 (GRCm39) probably null Het
Sipa1l2 A G 8: 126,171,274 (GRCm39) S1403P probably damaging Het
Sis C T 3: 72,872,937 (GRCm39) C67Y probably damaging Het
Specc1 A G 11: 62,019,218 (GRCm39) I686V possibly damaging Het
Speg G A 1: 75,394,507 (GRCm39) E1739K probably benign Het
Sprtn C A 8: 125,628,372 (GRCm39) H154Q probably damaging Het
St7l A G 3: 104,778,303 (GRCm39) T147A probably benign Het
Stab1 G A 14: 30,867,985 (GRCm39) Q1630* probably null Het
Stpg2 A G 3: 138,937,960 (GRCm39) D173G probably benign Het
Tcf20 G A 15: 82,736,978 (GRCm39) T1491I probably benign Het
Themis2 A T 4: 132,516,960 (GRCm39) I180N possibly damaging Het
Timd5 T C 11: 46,417,121 (GRCm39) L13P probably damaging Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Ttn A G 2: 76,638,340 (GRCm39) V13980A probably damaging Het
Ttn C T 2: 76,575,978 (GRCm39) V24972M probably damaging Het
Usp5 A T 6: 124,800,423 (GRCm39) M286K possibly damaging Het
Vmn2r22 G A 6: 123,614,802 (GRCm39) R263C possibly damaging Het
Vmn2r71 T G 7: 85,270,435 (GRCm39) C534G probably damaging Het
Wnk2 C T 13: 49,214,202 (GRCm39) S1460N possibly damaging Het
Zfp445 G A 9: 122,681,707 (GRCm39) P745S probably damaging Het
Zfp957 C T 14: 79,451,436 (GRCm39) G121D probably damaging Het
Zscan4f A G 7: 11,135,254 (GRCm39) E220G possibly damaging Het
Other mutations in Ap2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ap2b1 APN 11 83,223,984 (GRCm39) missense probably damaging 0.99
IGL01583:Ap2b1 APN 11 83,215,437 (GRCm39) missense possibly damaging 0.61
IGL01753:Ap2b1 APN 11 83,212,799 (GRCm39) missense probably damaging 1.00
IGL01992:Ap2b1 APN 11 83,226,356 (GRCm39) missense probably damaging 1.00
IGL02192:Ap2b1 APN 11 83,237,592 (GRCm39) missense possibly damaging 0.48
IGL02315:Ap2b1 APN 11 83,227,625 (GRCm39) missense probably damaging 0.96
IGL03235:Ap2b1 APN 11 83,232,210 (GRCm39) missense probably benign 0.41
P0045:Ap2b1 UTSW 11 83,258,852 (GRCm39) missense probably damaging 1.00
R0121:Ap2b1 UTSW 11 83,212,793 (GRCm39) missense possibly damaging 0.66
R0334:Ap2b1 UTSW 11 83,258,700 (GRCm39) splice site probably benign
R1222:Ap2b1 UTSW 11 83,237,564 (GRCm39) missense probably benign 0.06
R1297:Ap2b1 UTSW 11 83,223,935 (GRCm39) missense probably damaging 1.00
R1653:Ap2b1 UTSW 11 83,237,657 (GRCm39) missense probably damaging 1.00
R1885:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1886:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1965:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R1966:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R2046:Ap2b1 UTSW 11 83,227,212 (GRCm39) missense probably benign 0.14
R2086:Ap2b1 UTSW 11 83,241,944 (GRCm39) missense possibly damaging 0.88
R2132:Ap2b1 UTSW 11 83,215,587 (GRCm39) splice site probably benign
R3615:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R3616:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R3983:Ap2b1 UTSW 11 83,281,542 (GRCm39) missense probably damaging 1.00
R4124:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4125:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4198:Ap2b1 UTSW 11 83,233,429 (GRCm39) missense probably damaging 1.00
R4202:Ap2b1 UTSW 11 83,226,430 (GRCm39) critical splice donor site probably null
R4543:Ap2b1 UTSW 11 83,215,476 (GRCm39) missense probably damaging 1.00
R4583:Ap2b1 UTSW 11 83,288,605 (GRCm39) missense probably benign 0.00
R4589:Ap2b1 UTSW 11 83,223,837 (GRCm39) nonsense probably null
R4916:Ap2b1 UTSW 11 83,281,532 (GRCm39) missense probably damaging 1.00
R5005:Ap2b1 UTSW 11 83,230,218 (GRCm39) missense probably damaging 1.00
R5385:Ap2b1 UTSW 11 83,233,427 (GRCm39) missense probably damaging 1.00
R5510:Ap2b1 UTSW 11 83,227,563 (GRCm39) splice site probably null
R5738:Ap2b1 UTSW 11 83,227,256 (GRCm39) splice site probably null
R6023:Ap2b1 UTSW 11 83,226,224 (GRCm39) missense probably damaging 0.99
R6269:Ap2b1 UTSW 11 83,237,499 (GRCm39) missense probably damaging 1.00
R6383:Ap2b1 UTSW 11 83,237,651 (GRCm39) missense probably damaging 1.00
R6416:Ap2b1 UTSW 11 83,199,065 (GRCm39) start codon destroyed probably null 1.00
R6502:Ap2b1 UTSW 11 83,233,505 (GRCm39) missense probably damaging 0.97
R6810:Ap2b1 UTSW 11 83,226,317 (GRCm39) missense possibly damaging 0.89
R6969:Ap2b1 UTSW 11 83,280,552 (GRCm39) missense probably damaging 0.99
R7238:Ap2b1 UTSW 11 83,223,948 (GRCm39) missense possibly damaging 0.91
R7241:Ap2b1 UTSW 11 83,241,931 (GRCm39) missense probably benign 0.16
R7429:Ap2b1 UTSW 11 83,258,824 (GRCm39) missense probably benign 0.00
R7588:Ap2b1 UTSW 11 83,215,348 (GRCm39) missense probably benign 0.00
R7635:Ap2b1 UTSW 11 83,280,554 (GRCm39) missense probably benign 0.09
R7651:Ap2b1 UTSW 11 83,230,256 (GRCm39) critical splice donor site probably null
R7753:Ap2b1 UTSW 11 83,258,733 (GRCm39) nonsense probably null
R8468:Ap2b1 UTSW 11 83,241,891 (GRCm39) missense probably damaging 1.00
R8943:Ap2b1 UTSW 11 83,237,579 (GRCm39) missense probably damaging 1.00
R9093:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
R9621:Ap2b1 UTSW 11 83,293,424 (GRCm39) missense probably damaging 1.00
X0064:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
Z1177:Ap2b1 UTSW 11 83,256,579 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTGGAATGTTGGCTTGTAATCACC -3'
(R):5'- GCCTACAACTACCCTGTAGTCGTGTC -3'

Sequencing Primer
(F):5'- GTTGGCTTGTAATCACCTTGTATTC -3'
(R):5'- GAACGGGCTCACTTTCAATG -3'
Posted On 2014-05-14