Incidental Mutation 'R1719:Gm884'
ID191315
Institutional Source Beutler Lab
Gene Symbol Gm884
Ensembl Gene ENSMUSG00000034239
Gene Namepredicted gene 884
SynonymsLOC380730
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1719 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location103534577-103621140 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 103617071 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059279] [ENSMUST00000167262]
Predicted Effect unknown
Transcript: ENSMUST00000059279
AA Change: N1357I
SMART Domains Protein: ENSMUSP00000058511
Gene: ENSMUSG00000034239
AA Change: N1357I

DomainStartEndE-ValueType
Pfam:LRRC37 149 223 5.4e-10 PFAM
low complexity region 244 264 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
Pfam:LRRC37 335 403 1.9e-14 PFAM
Pfam:LRRC37 419 514 1.2e-8 PFAM
Pfam:LRRC37 565 620 2e-10 PFAM
Pfam:LRRC37 669 739 7.6e-18 PFAM
Pfam:LRRC37 741 792 1.6e-9 PFAM
Pfam:LRRC37 789 860 1.4e-23 PFAM
Pfam:LRRC37 861 914 2.8e-9 PFAM
Pfam:LRRC37 911 983 1.9e-23 PFAM
Pfam:LRRC37 979 1038 1e-8 PFAM
Pfam:LRRC37 1034 1105 2.7e-24 PFAM
Pfam:LRRC37 1105 1158 2.3e-9 PFAM
Pfam:LRRC37 1155 1219 2.4e-17 PFAM
Pfam:LRRC37 1222 1265 9.2e-7 PFAM
Pfam:LRRC37 1263 1330 4.9e-24 PFAM
Pfam:LRRC37 1331 1384 1.4e-10 PFAM
Pfam:LRRC37 1380 1451 4.3e-15 PFAM
Pfam:LRRC37 1487 1558 1.9e-15 PFAM
Pfam:LRRC37 1594 1665 2.9e-18 PFAM
Pfam:LRRC37 1701 1772 5.6e-23 PFAM
Pfam:LRRC37 1808 1910 2.8e-18 PFAM
Pfam:LRRC37 1915 1986 7.2e-17 PFAM
Pfam:LRRC37 2022 2093 4.9e-22 PFAM
Pfam:LRRC37 2129 2200 4.4e-22 PFAM
Pfam:LRRC37 2236 2307 2.1e-21 PFAM
Pfam:LRRC37 2343 2414 3.8e-17 PFAM
Pfam:LRRC37 2449 2519 1.6e-19 PFAM
LRR 2777 2796 3.09e1 SMART
LRR_TYP 2797 2820 2.09e-3 SMART
LRR 2821 2844 4.44e0 SMART
LRR 2848 2872 8.26e1 SMART
low complexity region 2991 3002 N/A INTRINSIC
low complexity region 3220 3230 N/A INTRINSIC
low complexity region 3382 3393 N/A INTRINSIC
Pfam:LRRC37AB_C 3424 3570 7.7e-76 PFAM
low complexity region 3571 3589 N/A INTRINSIC
low complexity region 3622 3640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167262
SMART Domains Protein: ENSMUSP00000129662
Gene: ENSMUSG00000034239

DomainStartEndE-ValueType
internal_repeat_1 1 70 1.46e-11 PROSPERO
internal_repeat_1 108 290 1.46e-11 PROSPERO
LRR 601 620 3.09e1 SMART
LRR_TYP 621 644 2.09e-3 SMART
LRR 645 668 4.44e0 SMART
LRR 672 696 8.26e1 SMART
low complexity region 815 826 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Pfam:LRRC37AB_C 1243 1396 1.2e-92 PFAM
low complexity region 1446 1464 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,248,206 M459K probably damaging Het
A1cf A T 19: 31,927,126 K263M probably damaging Het
Adam26a G A 8: 43,570,036 T139M possibly damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap9 C T 5: 3,957,645 Q238* probably null Het
Ankrd6 A T 4: 32,828,774 V85E probably damaging Het
Ap2b1 C A 11: 83,324,604 P125T probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Cblc A T 7: 19,790,474 D280E probably benign Het
Cdk11b T C 4: 155,648,397 probably benign Het
Cela2a G T 4: 141,817,946 F239L probably damaging Het
Cfap57 A T 4: 118,606,631 C342S probably benign Het
Clca4a C A 3: 144,963,755 W345L probably damaging Het
Col6a5 T C 9: 105,931,293 D852G unknown Het
Cyp4a32 T C 4: 115,611,308 V329A possibly damaging Het
Dcaf8 C T 1: 172,175,495 P287S probably damaging Het
Dmxl1 T A 18: 49,934,637 D2654E probably damaging Het
Dpep1 A T 8: 123,200,747 I347F possibly damaging Het
Dtnb T A 12: 3,643,936 Y56* probably null Het
Duox1 T C 2: 122,338,644 Y1182H possibly damaging Het
Dusp10 T A 1: 184,037,225 S129R probably benign Het
Epcam G A 17: 87,642,128 R173Q probably damaging Het
Ephb3 A G 16: 21,220,650 E384G probably damaging Het
Exosc10 A T 4: 148,568,503 D525V probably damaging Het
Fam186a T A 15: 99,942,346 T2006S possibly damaging Het
Fbxw21 T A 9: 109,148,174 T156S possibly damaging Het
Fcrl5 A G 3: 87,457,397 E568G probably damaging Het
Fmn2 C T 1: 174,608,458 probably benign Het
Fut9 A G 4: 25,619,744 F357L possibly damaging Het
Gas2l1 G A 11: 5,064,266 H65Y probably damaging Het
Gjd2 A T 2: 114,013,133 M1K probably null Het
Gm12169 T C 11: 46,526,294 L13P probably damaging Het
Hdgfl3 T C 7: 81,899,684 Y149C probably damaging Het
Hmcn2 T C 2: 31,354,721 V730A probably damaging Het
Inpp4a A T 1: 37,398,799 S223C probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Knl1 T A 2: 119,071,738 W1307R probably benign Het
Kpna3 A G 14: 61,387,477 L139P probably damaging Het
Lama3 T C 18: 12,479,872 probably null Het
Lin54 G A 5: 100,485,249 P192L possibly damaging Het
Lpo T A 11: 87,809,192 probably null Het
Lrrd1 T G 5: 3,850,483 probably null Het
Nbas T A 12: 13,560,977 probably null Het
Nemp1 G A 10: 127,696,248 G341D probably damaging Het
Nrp1 T C 8: 128,425,885 F192L probably damaging Het
Nufip2 T A 11: 77,693,090 V610E probably damaging Het
Nup160 T G 2: 90,700,436 Y479* probably null Het
Oas1d A T 5: 120,919,962 D323V possibly damaging Het
Olfr125 A G 17: 37,835,353 D118G possibly damaging Het
Olfr1338 A G 4: 118,753,600 W315R possibly damaging Het
Olfr140 T C 2: 90,051,784 Y180C probably damaging Het
Olfr147 G A 9: 38,403,254 V127M possibly damaging Het
Olfr204 T A 16: 59,314,706 R234* probably null Het
Olfr25 A T 9: 38,330,507 T307S probably benign Het
Olfr677 C A 7: 105,056,794 H183N probably damaging Het
Pcm1 T A 8: 41,313,359 M1567K possibly damaging Het
Pdxk A G 10: 78,443,896 V215A probably benign Het
Phf12 T A 11: 78,023,601 L74Q probably damaging Het
Plcg1 A G 2: 160,753,743 E537G probably null Het
Plxna2 C T 1: 194,644,370 P204L possibly damaging Het
Ppp3cb T G 14: 20,524,063 M236L probably benign Het
Qrsl1 A T 10: 43,896,030 S55T probably damaging Het
Rbm5 T C 9: 107,743,913 probably null Het
Sipa1l2 A G 8: 125,444,535 S1403P probably damaging Het
Sis C T 3: 72,965,604 C67Y probably damaging Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Speg G A 1: 75,417,863 E1739K probably benign Het
Sprtn C A 8: 124,901,633 H154Q probably damaging Het
St7l A G 3: 104,870,987 T147A probably benign Het
Stab1 G A 14: 31,146,028 Q1630* probably null Het
Stpg2 A G 3: 139,232,199 D173G probably benign Het
Tcf20 G A 15: 82,852,777 T1491I probably benign Het
Themis2 A T 4: 132,789,649 I180N possibly damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn C T 2: 76,745,634 V24972M probably damaging Het
Ttn A G 2: 76,807,996 V13980A probably damaging Het
Usp5 A T 6: 124,823,460 M286K possibly damaging Het
Vmn2r22 G A 6: 123,637,843 R263C possibly damaging Het
Vmn2r71 T G 7: 85,621,227 C534G probably damaging Het
Wdr60 T C 12: 116,255,912 I137V probably benign Het
Wnk2 C T 13: 49,060,726 S1460N possibly damaging Het
Zfp445 G A 9: 122,852,642 P745S probably damaging Het
Zfp957 C T 14: 79,213,996 G121D probably damaging Het
Zscan4f A G 7: 11,401,327 E220G possibly damaging Het
Other mutations in Gm884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Gm884 APN 11 103615410 missense probably benign 0.01
IGL00576:Gm884 APN 11 103617386 unclassified probably benign
IGL00813:Gm884 APN 11 103614498 missense probably benign 0.05
IGL01311:Gm884 APN 11 103534676 missense unknown
IGL01946:Gm884 APN 11 103612933 missense probably benign 0.28
IGL02217:Gm884 APN 11 103612871 splice site probably benign
IGL02556:Gm884 APN 11 103613283 missense probably benign 0.01
IGL02825:Gm884 APN 11 103617068 unclassified probably benign
IGL02868:Gm884 APN 11 103615139 missense probably benign 0.10
IGL02904:Gm884 APN 11 103616361 unclassified probably benign
IGL03008:Gm884 APN 11 103620467 missense unknown
IGL03120:Gm884 APN 11 103616975 unclassified probably benign
IGL03159:Gm884 APN 11 103604502 splice site probably benign
IGL03181:Gm884 APN 11 103616416 unclassified probably benign
IGL03202:Gm884 APN 11 103615373 missense probably benign 0.03
IGL03263:Gm884 APN 11 103613699 missense possibly damaging 0.86
PIT4486001:Gm884 UTSW 11 103618201 missense unknown
R0040:Gm884 UTSW 11 103542990 missense probably damaging 0.99
R0135:Gm884 UTSW 11 103618047 unclassified probably benign
R0141:Gm884 UTSW 11 103613686 missense probably damaging 1.00
R0226:Gm884 UTSW 11 103603241 missense probably benign 0.08
R0547:Gm884 UTSW 11 103620164 missense unknown
R0646:Gm884 UTSW 11 103613160 nonsense probably null
R0685:Gm884 UTSW 11 103616888 unclassified probably benign
R0732:Gm884 UTSW 11 103619838 missense unknown
R1015:Gm884 UTSW 11 103545796 missense probably benign 0.01
R1166:Gm884 UTSW 11 103615383 missense probably benign 0.21
R1168:Gm884 UTSW 11 103618950 unclassified probably benign
R1257:Gm884 UTSW 11 103534641 missense unknown
R1545:Gm884 UTSW 11 103608919 missense probably benign 0.16
R1570:Gm884 UTSW 11 103609938 missense possibly damaging 0.76
R1677:Gm884 UTSW 11 103614942 missense probably benign 0.19
R1703:Gm884 UTSW 11 103540874 missense probably benign 0.39
R1752:Gm884 UTSW 11 103614555 missense possibly damaging 0.67
R1870:Gm884 UTSW 11 103620605 missense unknown
R2155:Gm884 UTSW 11 103620459 missense unknown
R2191:Gm884 UTSW 11 103618967 unclassified probably benign
R2271:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R2378:Gm884 UTSW 11 103619711 unclassified probably benign
R2405:Gm884 UTSW 11 103620984 missense unknown
R2864:Gm884 UTSW 11 103540918 missense probably benign 0.34
R3011:Gm884 UTSW 11 103613103 missense possibly damaging 0.62
R3415:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3417:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3835:Gm884 UTSW 11 103620010 missense unknown
R3974:Gm884 UTSW 11 103619101 unclassified probably benign
R4019:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4020:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4176:Gm884 UTSW 11 103536600 missense unknown
R4361:Gm884 UTSW 11 103617501 frame shift probably null
R4418:Gm884 UTSW 11 103618314 unclassified probably benign
R4633:Gm884 UTSW 11 103619131 unclassified probably benign
R4693:Gm884 UTSW 11 103619860 missense unknown
R4758:Gm884 UTSW 11 103614464 missense possibly damaging 0.48
R4878:Gm884 UTSW 11 103617891 unclassified probably benign
R4887:Gm884 UTSW 11 103614872 missense probably benign 0.03
R4944:Gm884 UTSW 11 103613460 missense possibly damaging 0.68
R4952:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R5030:Gm884 UTSW 11 103534849 missense unknown
R5183:Gm884 UTSW 11 103543121 missense probably damaging 0.99
R5294:Gm884 UTSW 11 103616231 unclassified probably benign
R5317:Gm884 UTSW 11 103614145 missense possibly damaging 0.73
R5334:Gm884 UTSW 11 103613873 missense probably benign 0.18
R5426:Gm884 UTSW 11 103620760 missense unknown
R5467:Gm884 UTSW 11 103603265 nonsense probably null
R5518:Gm884 UTSW 11 103615253 missense probably benign 0.03
R5634:Gm884 UTSW 11 103542014 missense possibly damaging 0.95
R5647:Gm884 UTSW 11 103617474 unclassified probably benign
R5663:Gm884 UTSW 11 103613123 missense probably benign 0.01
R5668:Gm884 UTSW 11 103617054 unclassified probably benign
R5763:Gm884 UTSW 11 103613643 missense probably damaging 0.97
R5829:Gm884 UTSW 11 103541886 missense possibly damaging 0.95
R5871:Gm884 UTSW 11 103616454 unclassified probably benign
R5905:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R5940:Gm884 UTSW 11 103613886 missense probably benign 0.18
R5964:Gm884 UTSW 11 103542120 missense possibly damaging 0.92
R5988:Gm884 UTSW 11 103615896 unclassified probably benign
R5992:Gm884 UTSW 11 103613792 missense possibly damaging 0.81
R6114:Gm884 UTSW 11 103617791 unclassified probably benign
R6154:Gm884 UTSW 11 103614143 missense probably benign 0.33
R6233:Gm884 UTSW 11 103613388 missense probably damaging 0.98
R6301:Gm884 UTSW 11 103618930 unclassified probably benign
R6362:Gm884 UTSW 11 103620652 missense unknown
R6471:Gm884 UTSW 11 103619622 unclassified probably benign
R6806:Gm884 UTSW 11 103621124 missense unknown
R6962:Gm884 UTSW 11 103614300 missense possibly damaging 0.67
R6996:Gm884 UTSW 11 103618757 nonsense probably null
R7028:Gm884 UTSW 11 103614537 missense probably benign 0.28
R7034:Gm884 UTSW 11 103615812 unclassified probably benign
R7036:Gm884 UTSW 11 103615812 unclassified probably benign
R7113:Gm884 UTSW 11 103618799 missense unknown
R7405:Gm884 UTSW 11 103615161 missense probably benign 0.02
R7420:Gm884 UTSW 11 103613625 missense probably benign 0.11
R7461:Gm884 UTSW 11 103616290 missense unknown
R7544:Gm884 UTSW 11 103615448 missense probably benign 0.01
R7613:Gm884 UTSW 11 103616290 missense unknown
R7711:Gm884 UTSW 11 103614912 missense probably benign 0.02
R7714:Gm884 UTSW 11 103616893 missense unknown
R7747:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R7814:Gm884 UTSW 11 103614173 missense possibly damaging 0.53
R8053:Gm884 UTSW 11 103604566 missense unknown
R8063:Gm884 UTSW 11 103542261 missense unknown
R8116:Gm884 UTSW 11 103543289 missense unknown
R8124:Gm884 UTSW 11 103620431 missense unknown
R8141:Gm884 UTSW 11 103621029 missense unknown
R8163:Gm884 UTSW 11 103615862 missense unknown
R8270:Gm884 UTSW 11 103543315 missense unknown
R8348:Gm884 UTSW 11 103620900 missense unknown
R8362:Gm884 UTSW 11 103615337 missense probably benign 0.34
R8448:Gm884 UTSW 11 103620900 missense unknown
R8465:Gm884 UTSW 11 103616121 unclassified probably benign
R8473:Gm884 UTSW 11 103543440 missense unknown
R8781:Gm884 UTSW 11 103618132 missense unknown
R8821:Gm884 UTSW 11 103619644 missense unknown
R8859:Gm884 UTSW 11 103615544 missense unknown
R8888:Gm884 UTSW 11 103618830 missense unknown
R8895:Gm884 UTSW 11 103618830 missense unknown
Z1176:Gm884 UTSW 11 103613681 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- ATGGCGAGTTCCTGATCCACAGAC -3'
(R):5'- ATTTTCCAAAGCGCACTCAGCATC -3'

Sequencing Primer
(F):5'- GACTGTAATGACACACTGTTCGG -3'
(R):5'- CCAGTTATCAATCTACTGCTGAGGG -3'
Posted On2014-05-14