Incidental Mutation 'R1719:Tcf20'
ID 191324
Institutional Source Beutler Lab
Gene Symbol Tcf20
Ensembl Gene ENSMUSG00000041852
Gene Name transcription factor 20
Synonyms SPBP, stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik
Accession Numbers
Essential gene? Possibly essential (E-score: 0.692) question?
Stock # R1719 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 82692637-82872073 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 82736978 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1491 (T1491I)
Ref Sequence ENSEMBL: ENSMUSP00000105136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]
AlphaFold Q9EPQ8
Predicted Effect probably benign
Transcript: ENSMUST00000048966
AA Change: T1491I

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: T1491I

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109510
AA Change: T1491I

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: T1491I

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229439
Predicted Effect probably benign
Transcript: ENSMUST00000229547
Predicted Effect probably benign
Transcript: ENSMUST00000230403
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,904,526 (GRCm39) K263M probably damaging Het
Adam26a G A 8: 44,023,073 (GRCm39) T139M possibly damaging Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Akap9 C T 5: 4,007,645 (GRCm39) Q238* probably null Het
Ankrd6 A T 4: 32,828,774 (GRCm39) V85E probably damaging Het
Ap2b1 C A 11: 83,215,430 (GRCm39) P125T probably damaging Het
Arhgef7 C A 8: 11,858,713 (GRCm39) probably null Het
Cblc A T 7: 19,524,399 (GRCm39) D280E probably benign Het
Cdk11b T C 4: 155,732,854 (GRCm39) probably benign Het
Cela2a G T 4: 141,545,257 (GRCm39) F239L probably damaging Het
Cfap57 A T 4: 118,463,828 (GRCm39) C342S probably benign Het
Clca4a C A 3: 144,669,516 (GRCm39) W345L probably damaging Het
Col6a5 T C 9: 105,808,492 (GRCm39) D852G unknown Het
Cyp4a32 T C 4: 115,468,505 (GRCm39) V329A possibly damaging Het
Dcaf8 C T 1: 172,003,062 (GRCm39) P287S probably damaging Het
Dmxl1 T A 18: 50,067,704 (GRCm39) D2654E probably damaging Het
Dpep1 A T 8: 123,927,486 (GRCm39) I347F possibly damaging Het
Dtnb T A 12: 3,693,936 (GRCm39) Y56* probably null Het
Duox1 T C 2: 122,169,125 (GRCm39) Y1182H possibly damaging Het
Dusp10 T A 1: 183,769,422 (GRCm39) S129R probably benign Het
Dync2i1 T C 12: 116,219,532 (GRCm39) I137V probably benign Het
Epcam G A 17: 87,949,556 (GRCm39) R173Q probably damaging Het
Ephb3 A G 16: 21,039,400 (GRCm39) E384G probably damaging Het
Exosc10 A T 4: 148,652,960 (GRCm39) D525V probably damaging Het
Fam186a T A 15: 99,840,227 (GRCm39) T2006S possibly damaging Het
Fbxw21 T A 9: 108,977,242 (GRCm39) T156S possibly damaging Het
Fcrl5 A G 3: 87,364,704 (GRCm39) E568G probably damaging Het
Fmn2 C T 1: 174,436,024 (GRCm39) probably benign Het
Fut9 A G 4: 25,619,744 (GRCm39) F357L possibly damaging Het
Garre1 A T 7: 33,947,631 (GRCm39) M459K probably damaging Het
Gas2l1 G A 11: 5,014,266 (GRCm39) H65Y probably damaging Het
Gjd2 A T 2: 113,843,614 (GRCm39) M1K probably null Het
Hdgfl3 T C 7: 81,549,432 (GRCm39) Y149C probably damaging Het
Hmcn2 T C 2: 31,244,733 (GRCm39) V730A probably damaging Het
Inpp4a A T 1: 37,437,880 (GRCm39) S223C probably damaging Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Knl1 T A 2: 118,902,219 (GRCm39) W1307R probably benign Het
Kpna3 A G 14: 61,624,926 (GRCm39) L139P probably damaging Het
Lama3 T C 18: 12,612,929 (GRCm39) probably null Het
Lin54 G A 5: 100,633,108 (GRCm39) P192L possibly damaging Het
Lpo T A 11: 87,700,018 (GRCm39) probably null Het
Lrrc37 T A 11: 103,507,897 (GRCm39) probably benign Het
Lrrd1 T G 5: 3,900,483 (GRCm39) probably null Het
Nbas T A 12: 13,610,978 (GRCm39) probably null Het
Nemp1 G A 10: 127,532,117 (GRCm39) G341D probably damaging Het
Nrp1 T C 8: 129,152,366 (GRCm39) F192L probably damaging Het
Nufip2 T A 11: 77,583,916 (GRCm39) V610E probably damaging Het
Nup160 T G 2: 90,530,780 (GRCm39) Y479* probably null Het
Oas1d A T 5: 121,058,025 (GRCm39) D323V possibly damaging Het
Or10ak14 A G 4: 118,610,797 (GRCm39) W315R possibly damaging Het
Or14j1 A G 17: 38,146,244 (GRCm39) D118G possibly damaging Het
Or4c3d T C 2: 89,882,128 (GRCm39) Y180C probably damaging Het
Or52e4 C A 7: 104,706,001 (GRCm39) H183N probably damaging Het
Or5ac22 T A 16: 59,135,069 (GRCm39) R234* probably null Het
Or8b3 G A 9: 38,314,550 (GRCm39) V127M possibly damaging Het
Or8c9 A T 9: 38,241,803 (GRCm39) T307S probably benign Het
Pcm1 T A 8: 41,766,396 (GRCm39) M1567K possibly damaging Het
Pdxk A G 10: 78,279,730 (GRCm39) V215A probably benign Het
Phf12 T A 11: 77,914,427 (GRCm39) L74Q probably damaging Het
Plcg1 A G 2: 160,595,663 (GRCm39) E537G probably null Het
Plxna2 C T 1: 194,326,678 (GRCm39) P204L possibly damaging Het
Ppp3cb T G 14: 20,574,131 (GRCm39) M236L probably benign Het
Qrsl1 A T 10: 43,772,026 (GRCm39) S55T probably damaging Het
Rbm5 T C 9: 107,621,112 (GRCm39) probably null Het
Sipa1l2 A G 8: 126,171,274 (GRCm39) S1403P probably damaging Het
Sis C T 3: 72,872,937 (GRCm39) C67Y probably damaging Het
Specc1 A G 11: 62,019,218 (GRCm39) I686V possibly damaging Het
Speg G A 1: 75,394,507 (GRCm39) E1739K probably benign Het
Sprtn C A 8: 125,628,372 (GRCm39) H154Q probably damaging Het
St7l A G 3: 104,778,303 (GRCm39) T147A probably benign Het
Stab1 G A 14: 30,867,985 (GRCm39) Q1630* probably null Het
Stpg2 A G 3: 138,937,960 (GRCm39) D173G probably benign Het
Themis2 A T 4: 132,516,960 (GRCm39) I180N possibly damaging Het
Timd5 T C 11: 46,417,121 (GRCm39) L13P probably damaging Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Ttn A G 2: 76,638,340 (GRCm39) V13980A probably damaging Het
Ttn C T 2: 76,575,978 (GRCm39) V24972M probably damaging Het
Usp5 A T 6: 124,800,423 (GRCm39) M286K possibly damaging Het
Vmn2r22 G A 6: 123,614,802 (GRCm39) R263C possibly damaging Het
Vmn2r71 T G 7: 85,270,435 (GRCm39) C534G probably damaging Het
Wnk2 C T 13: 49,214,202 (GRCm39) S1460N possibly damaging Het
Zfp445 G A 9: 122,681,707 (GRCm39) P745S probably damaging Het
Zfp957 C T 14: 79,451,436 (GRCm39) G121D probably damaging Het
Zscan4f A G 7: 11,135,254 (GRCm39) E220G possibly damaging Het
Other mutations in Tcf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tcf20 APN 15 82,739,096 (GRCm39) missense probably damaging 1.00
IGL00229:Tcf20 APN 15 82,741,343 (GRCm39) missense possibly damaging 0.50
IGL00539:Tcf20 APN 15 82,736,957 (GRCm39) missense probably benign 0.41
IGL00576:Tcf20 APN 15 82,740,276 (GRCm39) missense probably damaging 1.00
IGL01135:Tcf20 APN 15 82,738,101 (GRCm39) missense probably benign
IGL01670:Tcf20 APN 15 82,739,564 (GRCm39) missense possibly damaging 0.77
IGL01684:Tcf20 APN 15 82,741,361 (GRCm39) missense probably damaging 1.00
IGL01767:Tcf20 APN 15 82,740,209 (GRCm39) missense probably damaging 1.00
IGL01825:Tcf20 APN 15 82,737,167 (GRCm39) missense probably benign
IGL01834:Tcf20 APN 15 82,739,898 (GRCm39) missense probably damaging 0.99
IGL01836:Tcf20 APN 15 82,739,356 (GRCm39) missense probably damaging 0.99
IGL02415:Tcf20 APN 15 82,737,660 (GRCm39) missense probably benign 0.28
IGL02731:Tcf20 APN 15 82,737,438 (GRCm39) missense probably benign 0.00
IGL02739:Tcf20 APN 15 82,740,281 (GRCm39) missense probably damaging 1.00
IGL03058:Tcf20 APN 15 82,736,205 (GRCm39) missense probably damaging 0.96
PIT4131001:Tcf20 UTSW 15 82,735,785 (GRCm39) missense probably damaging 0.96
R0184:Tcf20 UTSW 15 82,736,501 (GRCm39) missense probably damaging 0.99
R0207:Tcf20 UTSW 15 82,739,286 (GRCm39) missense probably benign
R0732:Tcf20 UTSW 15 82,736,504 (GRCm39) missense probably benign 0.07
R1502:Tcf20 UTSW 15 82,739,777 (GRCm39) missense probably damaging 1.00
R1575:Tcf20 UTSW 15 82,739,693 (GRCm39) missense probably benign 0.19
R1997:Tcf20 UTSW 15 82,741,431 (GRCm39) nonsense probably null
R2152:Tcf20 UTSW 15 82,739,803 (GRCm39) missense probably damaging 1.00
R2173:Tcf20 UTSW 15 82,738,893 (GRCm39) missense possibly damaging 0.62
R2288:Tcf20 UTSW 15 82,735,886 (GRCm39) missense probably benign
R4049:Tcf20 UTSW 15 82,737,630 (GRCm39) missense probably damaging 1.00
R4496:Tcf20 UTSW 15 82,739,185 (GRCm39) missense probably damaging 1.00
R4704:Tcf20 UTSW 15 82,735,928 (GRCm39) missense possibly damaging 0.49
R4892:Tcf20 UTSW 15 82,738,400 (GRCm39) missense possibly damaging 0.80
R5164:Tcf20 UTSW 15 82,740,804 (GRCm39) missense probably damaging 1.00
R5207:Tcf20 UTSW 15 82,740,386 (GRCm39) missense probably damaging 0.98
R5219:Tcf20 UTSW 15 82,740,582 (GRCm39) missense probably damaging 1.00
R5228:Tcf20 UTSW 15 82,740,156 (GRCm39) missense probably benign 0.01
R5288:Tcf20 UTSW 15 82,739,910 (GRCm39) missense possibly damaging 0.50
R5374:Tcf20 UTSW 15 82,736,158 (GRCm39) missense probably damaging 0.99
R5384:Tcf20 UTSW 15 82,740,400 (GRCm39) missense probably damaging 0.99
R5677:Tcf20 UTSW 15 82,737,443 (GRCm39) missense probably benign 0.05
R5897:Tcf20 UTSW 15 82,735,984 (GRCm39) nonsense probably null
R6089:Tcf20 UTSW 15 82,737,409 (GRCm39) missense probably benign 0.06
R6196:Tcf20 UTSW 15 82,736,187 (GRCm39) missense possibly damaging 0.89
R6229:Tcf20 UTSW 15 82,739,081 (GRCm39) missense probably damaging 1.00
R6448:Tcf20 UTSW 15 82,736,861 (GRCm39) missense probably benign
R6688:Tcf20 UTSW 15 82,738,736 (GRCm39) missense possibly damaging 0.68
R7009:Tcf20 UTSW 15 82,738,883 (GRCm39) missense probably benign 0.07
R7051:Tcf20 UTSW 15 82,740,279 (GRCm39) missense probably damaging 1.00
R7215:Tcf20 UTSW 15 82,737,690 (GRCm39) missense probably benign
R7486:Tcf20 UTSW 15 82,737,935 (GRCm39) missense possibly damaging 0.78
R7583:Tcf20 UTSW 15 82,739,477 (GRCm39) missense possibly damaging 0.82
R7678:Tcf20 UTSW 15 82,735,766 (GRCm39) missense possibly damaging 0.92
R8090:Tcf20 UTSW 15 82,740,207 (GRCm39) missense probably damaging 1.00
R8156:Tcf20 UTSW 15 82,737,138 (GRCm39) missense probably benign 0.00
R8191:Tcf20 UTSW 15 82,737,606 (GRCm39) nonsense probably null
R8259:Tcf20 UTSW 15 82,736,474 (GRCm39) missense probably damaging 1.00
R8339:Tcf20 UTSW 15 82,736,877 (GRCm39) missense probably benign 0.04
R8447:Tcf20 UTSW 15 82,737,437 (GRCm39) missense possibly damaging 0.77
R8497:Tcf20 UTSW 15 82,740,152 (GRCm39) missense probably benign 0.07
R8728:Tcf20 UTSW 15 82,739,158 (GRCm39) missense probably damaging 1.00
R8829:Tcf20 UTSW 15 82,739,915 (GRCm39) missense probably damaging 1.00
R8861:Tcf20 UTSW 15 82,736,726 (GRCm39) missense probably damaging 0.99
R9177:Tcf20 UTSW 15 82,740,705 (GRCm39) missense probably benign 0.00
R9268:Tcf20 UTSW 15 82,740,705 (GRCm39) missense probably benign 0.00
R9294:Tcf20 UTSW 15 82,736,897 (GRCm39) missense probably benign 0.11
R9648:Tcf20 UTSW 15 82,739,876 (GRCm39) missense probably damaging 1.00
R9675:Tcf20 UTSW 15 82,740,986 (GRCm39) missense probably damaging 1.00
R9729:Tcf20 UTSW 15 82,736,037 (GRCm39) missense probably benign 0.25
RF019:Tcf20 UTSW 15 82,735,794 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGGTTCTACAATGGGAACTGCTTG -3'
(R):5'- TCTAAAGAGTGGTCCTCCTGAAGGTG -3'

Sequencing Primer
(F):5'- AGAACCTTCTGGCATCTGAG -3'
(R):5'- CTCCTGAAGGTGGCACTGTG -3'
Posted On 2014-05-14