Mutagenetix > Incidental Mutation

Incidental Mutation 'R1719:Tcf20'

191324

Institutional Source

Beutler Lab

Gene Symbol

Tcf20

Ensembl Gene

ENSMUSG00000041852

Gene Name

transcription factor 20

Synonyms

stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.656) question?

Stock #

R1719 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82808436-82987872 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 82852777 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1491 (T1491I)

Ref Sequence

ENSEMBL: ENSMUSP00000105136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]

AlphaFold

Q9EPQ8

Predicted Effect

probably benign
Transcript: ENSMUST00000048966
AA Change: T1491I

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: T1491I

Domain	Start	End	E-Value	Type
low complexity region	42	74	N/A	INTRINSIC
coiled coil region	163	203	N/A	INTRINSIC
low complexity region	248	277	N/A	INTRINSIC
low complexity region	322	354	N/A	INTRINSIC
low complexity region	396	416	N/A	INTRINSIC
low complexity region	443	456	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC
low complexity region	511	523	N/A	INTRINSIC
low complexity region	684	715	N/A	INTRINSIC
low complexity region	1047	1056	N/A	INTRINSIC
low complexity region	1532	1544	N/A	INTRINSIC
low complexity region	1577	1593	N/A	INTRINSIC
low complexity region	1602	1617	N/A	INTRINSIC
low complexity region	1793	1804	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
PHD	1913	1960	6.7e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109510
AA Change: T1491I

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: T1491I

Domain	Start	End	E-Value	Type
low complexity region	42	74	N/A	INTRINSIC
coiled coil region	163	203	N/A	INTRINSIC
low complexity region	248	277	N/A	INTRINSIC
low complexity region	322	354	N/A	INTRINSIC
low complexity region	396	416	N/A	INTRINSIC
low complexity region	443	456	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC
low complexity region	511	523	N/A	INTRINSIC
low complexity region	684	715	N/A	INTRINSIC
low complexity region	1047	1056	N/A	INTRINSIC
low complexity region	1532	1544	N/A	INTRINSIC
low complexity region	1577	1593	N/A	INTRINSIC
low complexity region	1602	1617	N/A	INTRINSIC
low complexity region	1793	1804	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
PHD	1913	1960	6.7e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229439

Predicted Effect

probably benign
Transcript: ENSMUST00000229547

Predicted Effect

probably benign
Transcript: ENSMUST00000230403

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,248,206	M459K	probably damaging	Het
A1cf	A	T	19: 31,927,126	K263M	probably damaging	Het
Adam26a	G	A	8: 43,570,036	T139M	possibly damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Akap9	C	T	5: 3,957,645	Q238*	probably null	Het
Ankrd6	A	T	4: 32,828,774	V85E	probably damaging	Het
Ap2b1	C	A	11: 83,324,604	P125T	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Cblc	A	T	7: 19,790,474	D280E	probably benign	Het
Cdk11b	T	C	4: 155,648,397		probably benign	Het
Cela2a	G	T	4: 141,817,946	F239L	probably damaging	Het
Cfap57	A	T	4: 118,606,631	C342S	probably benign	Het
Clca4a	C	A	3: 144,963,755	W345L	probably damaging	Het
Col6a5	T	C	9: 105,931,293	D852G	unknown	Het
Cyp4a32	T	C	4: 115,611,308	V329A	possibly damaging	Het
Dcaf8	C	T	1: 172,175,495	P287S	probably damaging	Het
Dmxl1	T	A	18: 49,934,637	D2654E	probably damaging	Het
Dpep1	A	T	8: 123,200,747	I347F	possibly damaging	Het
Dtnb	T	A	12: 3,643,936	Y56*	probably null	Het
Duox1	T	C	2: 122,338,644	Y1182H	possibly damaging	Het
Dusp10	T	A	1: 184,037,225	S129R	probably benign	Het
Epcam	G	A	17: 87,642,128	R173Q	probably damaging	Het
Ephb3	A	G	16: 21,220,650	E384G	probably damaging	Het
Exosc10	A	T	4: 148,568,503	D525V	probably damaging	Het
Fam186a	T	A	15: 99,942,346	T2006S	possibly damaging	Het
Fbxw21	T	A	9: 109,148,174	T156S	possibly damaging	Het
Fcrl5	A	G	3: 87,457,397	E568G	probably damaging	Het
Fmn2	C	T	1: 174,608,458		probably benign	Het
Fut9	A	G	4: 25,619,744	F357L	possibly damaging	Het
Gas2l1	G	A	11: 5,064,266	H65Y	probably damaging	Het
Gjd2	A	T	2: 114,013,133	M1K	probably null	Het
Gm12169	T	C	11: 46,526,294	L13P	probably damaging	Het
Gm884	T	A	11: 103,617,071		probably benign	Het
Hdgfl3	T	C	7: 81,899,684	Y149C	probably damaging	Het
Hmcn2	T	C	2: 31,354,721	V730A	probably damaging	Het
Inpp4a	A	T	1: 37,398,799	S223C	probably damaging	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Knl1	T	A	2: 119,071,738	W1307R	probably benign	Het
Kpna3	A	G	14: 61,387,477	L139P	probably damaging	Het
Lama3	T	C	18: 12,479,872		probably null	Het
Lin54	G	A	5: 100,485,249	P192L	possibly damaging	Het
Lpo	T	A	11: 87,809,192		probably null	Het
Lrrd1	T	G	5: 3,850,483		probably null	Het
Nbas	T	A	12: 13,560,977		probably null	Het
Nemp1	G	A	10: 127,696,248	G341D	probably damaging	Het
Nrp1	T	C	8: 128,425,885	F192L	probably damaging	Het
Nufip2	T	A	11: 77,693,090	V610E	probably damaging	Het
Nup160	T	G	2: 90,700,436	Y479*	probably null	Het
Oas1d	A	T	5: 120,919,962	D323V	possibly damaging	Het
Olfr125	A	G	17: 37,835,353	D118G	possibly damaging	Het
Olfr1338	A	G	4: 118,753,600	W315R	possibly damaging	Het
Olfr140	T	C	2: 90,051,784	Y180C	probably damaging	Het
Olfr147	G	A	9: 38,403,254	V127M	possibly damaging	Het
Olfr204	T	A	16: 59,314,706	R234*	probably null	Het
Olfr25	A	T	9: 38,330,507	T307S	probably benign	Het
Olfr677	C	A	7: 105,056,794	H183N	probably damaging	Het
Pcm1	T	A	8: 41,313,359	M1567K	possibly damaging	Het
Pdxk	A	G	10: 78,443,896	V215A	probably benign	Het
Phf12	T	A	11: 78,023,601	L74Q	probably damaging	Het
Plcg1	A	G	2: 160,753,743	E537G	probably null	Het
Plxna2	C	T	1: 194,644,370	P204L	possibly damaging	Het
Ppp3cb	T	G	14: 20,524,063	M236L	probably benign	Het
Qrsl1	A	T	10: 43,896,030	S55T	probably damaging	Het
Rbm5	T	C	9: 107,743,913		probably null	Het
Sipa1l2	A	G	8: 125,444,535	S1403P	probably damaging	Het
Sis	C	T	3: 72,965,604	C67Y	probably damaging	Het
Specc1	A	G	11: 62,128,392	I686V	possibly damaging	Het
Speg	G	A	1: 75,417,863	E1739K	probably benign	Het
Sprtn	C	A	8: 124,901,633	H154Q	probably damaging	Het
St7l	A	G	3: 104,870,987	T147A	probably benign	Het
Stab1	G	A	14: 31,146,028	Q1630*	probably null	Het
Stpg2	A	G	3: 139,232,199	D173G	probably benign	Het
Themis2	A	T	4: 132,789,649	I180N	possibly damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	C	T	2: 76,745,634	V24972M	probably damaging	Het
Ttn	A	G	2: 76,807,996	V13980A	probably damaging	Het
Usp5	A	T	6: 124,823,460	M286K	possibly damaging	Het
Vmn2r22	G	A	6: 123,637,843	R263C	possibly damaging	Het
Vmn2r71	T	G	7: 85,621,227	C534G	probably damaging	Het
Wdr60	T	C	12: 116,255,912	I137V	probably benign	Het
Wnk2	C	T	13: 49,060,726	S1460N	possibly damaging	Het
Zfp445	G	A	9: 122,852,642	P745S	probably damaging	Het
Zfp957	C	T	14: 79,213,996	G121D	probably damaging	Het
Zscan4f	A	G	7: 11,401,327	E220G	possibly damaging	Het

Other mutations in Tcf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Tcf20	APN	15	82854895	missense	probably damaging	1.00
IGL00229:Tcf20	APN	15	82857142	missense	possibly damaging	0.50
IGL00539:Tcf20	APN	15	82852756	missense	probably benign	0.41
IGL00576:Tcf20	APN	15	82856075	missense	probably damaging	1.00
IGL01135:Tcf20	APN	15	82853900	missense	probably benign
IGL01670:Tcf20	APN	15	82855363	missense	possibly damaging	0.77
IGL01684:Tcf20	APN	15	82857160	missense	probably damaging	1.00
IGL01767:Tcf20	APN	15	82856008	missense	probably damaging	1.00
IGL01825:Tcf20	APN	15	82852966	missense	probably benign
IGL01834:Tcf20	APN	15	82855697	missense	probably damaging	0.99
IGL01836:Tcf20	APN	15	82855155	missense	probably damaging	0.99
IGL02415:Tcf20	APN	15	82853459	missense	probably benign	0.28
IGL02731:Tcf20	APN	15	82853237	missense	probably benign	0.00
IGL02739:Tcf20	APN	15	82856080	missense	probably damaging	1.00
IGL03058:Tcf20	APN	15	82852004	missense	probably damaging	0.96
PIT4131001:Tcf20	UTSW	15	82851584	missense	probably damaging	0.96
R0184:Tcf20	UTSW	15	82852300	missense	probably damaging	0.99
R0207:Tcf20	UTSW	15	82855085	missense	probably benign
R0732:Tcf20	UTSW	15	82852303	missense	probably benign	0.07
R1502:Tcf20	UTSW	15	82855576	missense	probably damaging	1.00
R1575:Tcf20	UTSW	15	82855492	missense	probably benign	0.19
R1997:Tcf20	UTSW	15	82857230	nonsense	probably null
R2152:Tcf20	UTSW	15	82855602	missense	probably damaging	1.00
R2173:Tcf20	UTSW	15	82854692	missense	possibly damaging	0.62
R2288:Tcf20	UTSW	15	82851685	missense	probably benign
R4049:Tcf20	UTSW	15	82853429	missense	probably damaging	1.00
R4496:Tcf20	UTSW	15	82854984	missense	probably damaging	1.00
R4704:Tcf20	UTSW	15	82851727	missense	possibly damaging	0.49
R4892:Tcf20	UTSW	15	82854199	missense	possibly damaging	0.80
R5164:Tcf20	UTSW	15	82856603	missense	probably damaging	1.00
R5207:Tcf20	UTSW	15	82856185	missense	probably damaging	0.98
R5219:Tcf20	UTSW	15	82856381	missense	probably damaging	1.00
R5228:Tcf20	UTSW	15	82855955	missense	probably benign	0.01
R5288:Tcf20	UTSW	15	82855709	missense	possibly damaging	0.50
R5374:Tcf20	UTSW	15	82851957	missense	probably damaging	0.99
R5384:Tcf20	UTSW	15	82856199	missense	probably damaging	0.99
R5677:Tcf20	UTSW	15	82853242	missense	probably benign	0.05
R5897:Tcf20	UTSW	15	82851783	nonsense	probably null
R6089:Tcf20	UTSW	15	82853208	missense	probably benign	0.06
R6196:Tcf20	UTSW	15	82851986	missense	possibly damaging	0.89
R6229:Tcf20	UTSW	15	82854880	missense	probably damaging	1.00
R6448:Tcf20	UTSW	15	82852660	missense	probably benign
R6688:Tcf20	UTSW	15	82854535	missense	possibly damaging	0.68
R7009:Tcf20	UTSW	15	82854682	missense	probably benign	0.07
R7051:Tcf20	UTSW	15	82856078	missense	probably damaging	1.00
R7215:Tcf20	UTSW	15	82853489	missense	probably benign
R7486:Tcf20	UTSW	15	82853734	missense	possibly damaging	0.78
R7583:Tcf20	UTSW	15	82855276	missense	possibly damaging	0.82
R7678:Tcf20	UTSW	15	82851565	missense	possibly damaging	0.92
R8090:Tcf20	UTSW	15	82856006	missense	probably damaging	1.00
R8156:Tcf20	UTSW	15	82852937	missense	probably benign	0.00
R8191:Tcf20	UTSW	15	82853405	nonsense	probably null
R8259:Tcf20	UTSW	15	82852273	missense	probably damaging	1.00
R8339:Tcf20	UTSW	15	82852676	missense	probably benign	0.04
R8447:Tcf20	UTSW	15	82853236	missense	possibly damaging	0.77
R8497:Tcf20	UTSW	15	82855951	missense	probably benign	0.07
R8728:Tcf20	UTSW	15	82854957	missense	probably damaging	1.00
R8829:Tcf20	UTSW	15	82855714	missense	probably damaging	1.00
R8861:Tcf20	UTSW	15	82852525	missense	probably damaging	0.99
R9177:Tcf20	UTSW	15	82856504	missense	probably benign	0.00
R9268:Tcf20	UTSW	15	82856504	missense	probably benign	0.00
R9294:Tcf20	UTSW	15	82852696	missense	probably benign	0.11
R9648:Tcf20	UTSW	15	82855675	missense	probably damaging	1.00
R9675:Tcf20	UTSW	15	82856785	missense	probably damaging	1.00
R9729:Tcf20	UTSW	15	82851836	missense	probably benign	0.25
RF019:Tcf20	UTSW	15	82851593	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGAGGTTCTACAATGGGAACTGCTTG -3'
(R):5'- TCTAAAGAGTGGTCCTCCTGAAGGTG -3'

Sequencing Primer
(F):5'- AGAACCTTCTGGCATCTGAG -3'
(R):5'- CTCCTGAAGGTGGCACTGTG -3'

Posted On

2014-05-14