Mutagenetix > Incidental Mutation

Incidental Mutation 'R1719:Olfr204'

191328

Institutional Source

Beutler Lab

Gene Symbol

Olfr204

Ensembl Gene

ENSMUSG00000095928

Gene Name

olfactory receptor 204

Synonyms

GA_x54KRFPKG5P-55529713-55528796, MOR182-3

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R1719 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59310206-59318248 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 59314706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 234 (R234*)

Ref Sequence

ENSEMBL: ENSMUSP00000151176 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072517] [ENSMUST00000207927] [ENSMUST00000216261]

AlphaFold

E9Q8M0

Predicted Effect

probably null
Transcript: ENSMUST00000072517
AA Change: R234*

SMART Domains

Protein: ENSMUSP00000072332
Gene: ENSMUSG00000095928
AA Change: R234*

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	305	1.5e-49	PFAM
Pfam:7TM_GPCR_Srsx	34	299	2.3e-9	PFAM
Pfam:7tm_1	40	289	3.4e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207927
AA Change: R234*

Predicted Effect

probably null
Transcript: ENSMUST00000216261
AA Change: R234*

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,248,206	M459K	probably damaging	Het
A1cf	A	T	19: 31,927,126	K263M	probably damaging	Het
Adam26a	G	A	8: 43,570,036	T139M	possibly damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Akap9	C	T	5: 3,957,645	Q238*	probably null	Het
Ankrd6	A	T	4: 32,828,774	V85E	probably damaging	Het
Ap2b1	C	A	11: 83,324,604	P125T	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Cblc	A	T	7: 19,790,474	D280E	probably benign	Het
Cdk11b	T	C	4: 155,648,397		probably benign	Het
Cela2a	G	T	4: 141,817,946	F239L	probably damaging	Het
Cfap57	A	T	4: 118,606,631	C342S	probably benign	Het
Clca4a	C	A	3: 144,963,755	W345L	probably damaging	Het
Col6a5	T	C	9: 105,931,293	D852G	unknown	Het
Cyp4a32	T	C	4: 115,611,308	V329A	possibly damaging	Het
Dcaf8	C	T	1: 172,175,495	P287S	probably damaging	Het
Dmxl1	T	A	18: 49,934,637	D2654E	probably damaging	Het
Dpep1	A	T	8: 123,200,747	I347F	possibly damaging	Het
Dtnb	T	A	12: 3,643,936	Y56*	probably null	Het
Duox1	T	C	2: 122,338,644	Y1182H	possibly damaging	Het
Dusp10	T	A	1: 184,037,225	S129R	probably benign	Het
Epcam	G	A	17: 87,642,128	R173Q	probably damaging	Het
Ephb3	A	G	16: 21,220,650	E384G	probably damaging	Het
Exosc10	A	T	4: 148,568,503	D525V	probably damaging	Het
Fam186a	T	A	15: 99,942,346	T2006S	possibly damaging	Het
Fbxw21	T	A	9: 109,148,174	T156S	possibly damaging	Het
Fcrl5	A	G	3: 87,457,397	E568G	probably damaging	Het
Fmn2	C	T	1: 174,608,458		probably benign	Het
Fut9	A	G	4: 25,619,744	F357L	possibly damaging	Het
Gas2l1	G	A	11: 5,064,266	H65Y	probably damaging	Het
Gjd2	A	T	2: 114,013,133	M1K	probably null	Het
Gm12169	T	C	11: 46,526,294	L13P	probably damaging	Het
Gm884	T	A	11: 103,617,071		probably benign	Het
Hdgfl3	T	C	7: 81,899,684	Y149C	probably damaging	Het
Hmcn2	T	C	2: 31,354,721	V730A	probably damaging	Het
Inpp4a	A	T	1: 37,398,799	S223C	probably damaging	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Knl1	T	A	2: 119,071,738	W1307R	probably benign	Het
Kpna3	A	G	14: 61,387,477	L139P	probably damaging	Het
Lama3	T	C	18: 12,479,872		probably null	Het
Lin54	G	A	5: 100,485,249	P192L	possibly damaging	Het
Lpo	T	A	11: 87,809,192		probably null	Het
Lrrd1	T	G	5: 3,850,483		probably null	Het
Nbas	T	A	12: 13,560,977		probably null	Het
Nemp1	G	A	10: 127,696,248	G341D	probably damaging	Het
Nrp1	T	C	8: 128,425,885	F192L	probably damaging	Het
Nufip2	T	A	11: 77,693,090	V610E	probably damaging	Het
Nup160	T	G	2: 90,700,436	Y479*	probably null	Het
Oas1d	A	T	5: 120,919,962	D323V	possibly damaging	Het
Olfr125	A	G	17: 37,835,353	D118G	possibly damaging	Het
Olfr1338	A	G	4: 118,753,600	W315R	possibly damaging	Het
Olfr140	T	C	2: 90,051,784	Y180C	probably damaging	Het
Olfr147	G	A	9: 38,403,254	V127M	possibly damaging	Het
Olfr25	A	T	9: 38,330,507	T307S	probably benign	Het
Olfr677	C	A	7: 105,056,794	H183N	probably damaging	Het
Pcm1	T	A	8: 41,313,359	M1567K	possibly damaging	Het
Pdxk	A	G	10: 78,443,896	V215A	probably benign	Het
Phf12	T	A	11: 78,023,601	L74Q	probably damaging	Het
Plcg1	A	G	2: 160,753,743	E537G	probably null	Het
Plxna2	C	T	1: 194,644,370	P204L	possibly damaging	Het
Ppp3cb	T	G	14: 20,524,063	M236L	probably benign	Het
Qrsl1	A	T	10: 43,896,030	S55T	probably damaging	Het
Rbm5	T	C	9: 107,743,913		probably null	Het
Sipa1l2	A	G	8: 125,444,535	S1403P	probably damaging	Het
Sis	C	T	3: 72,965,604	C67Y	probably damaging	Het
Specc1	A	G	11: 62,128,392	I686V	possibly damaging	Het
Speg	G	A	1: 75,417,863	E1739K	probably benign	Het
Sprtn	C	A	8: 124,901,633	H154Q	probably damaging	Het
St7l	A	G	3: 104,870,987	T147A	probably benign	Het
Stab1	G	A	14: 31,146,028	Q1630*	probably null	Het
Stpg2	A	G	3: 139,232,199	D173G	probably benign	Het
Tcf20	G	A	15: 82,852,777	T1491I	probably benign	Het
Themis2	A	T	4: 132,789,649	I180N	possibly damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	C	T	2: 76,745,634	V24972M	probably damaging	Het
Ttn	A	G	2: 76,807,996	V13980A	probably damaging	Het
Usp5	A	T	6: 124,823,460	M286K	possibly damaging	Het
Vmn2r22	G	A	6: 123,637,843	R263C	possibly damaging	Het
Vmn2r71	T	G	7: 85,621,227	C534G	probably damaging	Het
Wdr60	T	C	12: 116,255,912	I137V	probably benign	Het
Wnk2	C	T	13: 49,060,726	S1460N	possibly damaging	Het
Zfp445	G	A	9: 122,852,642	P745S	probably damaging	Het
Zfp957	C	T	14: 79,213,996	G121D	probably damaging	Het
Zscan4f	A	G	7: 11,401,327	E220G	possibly damaging	Het

Other mutations in Olfr204

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01771:Olfr204	APN	16	59314528	missense	probably damaging	1.00
IGL01915:Olfr204	APN	16	59315110	missense	probably damaging	1.00
R0265:Olfr204	UTSW	16	59315071	missense	probably damaging	1.00
R0532:Olfr204	UTSW	16	59314601	missense	probably benign	0.00
R1864:Olfr204	UTSW	16	59315015	missense	probably damaging	1.00
R1889:Olfr204	UTSW	16	59314963	missense	probably damaging	0.98
R1925:Olfr204	UTSW	16	59314664	missense	probably damaging	1.00
R2973:Olfr204	UTSW	16	59315404	start codon destroyed	probably null	1.00
R3078:Olfr204	UTSW	16	59314726	missense	probably benign
R3819:Olfr204	UTSW	16	59315071	missense	probably damaging	1.00
R4036:Olfr204	UTSW	16	59314750	missense	probably benign
R4698:Olfr204	UTSW	16	59315357	missense	probably damaging	1.00
R4930:Olfr204	UTSW	16	59314873	missense	probably damaging	1.00
R5457:Olfr204	UTSW	16	59314850	missense	probably benign	0.12
R6597:Olfr204	UTSW	16	59315350	missense	probably benign	0.00
R7341:Olfr204	UTSW	16	59315149	missense	possibly damaging	0.69
R7512:Olfr204	UTSW	16	59315027	missense	probably damaging	0.99
R7702:Olfr204	UTSW	16	59314634	missense	probably damaging	1.00
R8132:Olfr204	UTSW	16	59314544	missense	possibly damaging	0.55
R9642:Olfr204	UTSW	16	59315247	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- AGAGCACCCAAAACTTCCTTGTTTCTT -3'
(R):5'- GCAATGGCCTATGACCGCTATGT -3'

Sequencing Primer
(F):5'- CAAAACTTCCTTGTTTCTTAAGCTG -3'
(R):5'- GATGTCCAAGAGACTCTGTACTG -3'

Posted On

2014-05-14