Mutagenetix > Incidental Mutation

Incidental Mutation 'R1719:A1cf'

191334

Institutional Source

Beutler Lab

Gene Symbol

A1cf

Ensembl Gene

ENSMUSG00000052595

Gene Name

APOBEC1 complementation factor

Synonyms

apobec-1 complementation factor, ACF, 1810073H04Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R1719 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31868764-31948573 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31927126 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Methionine at position 263 (K263M)

Ref Sequence

ENSEMBL: ENSMUSP00000153465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075838] [ENSMUST00000224304] [ENSMUST00000224400] [ENSMUST00000224564]

AlphaFold

Q5YD48

Predicted Effect

probably damaging
Transcript: ENSMUST00000075838
AA Change: K263M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075235
Gene: ENSMUSG00000052595
AA Change: K263M

Domain	Start	End	E-Value	Type
RRM	57	130	2.13e-18	SMART
RRM	137	214	1.59e-8	SMART
RRM	232	299	1.36e-16	SMART
low complexity region	386	411	N/A	INTRINSIC
Pfam:DND1_DSRM	445	523	1.6e-30	PFAM
low complexity region	526	542	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000224304
AA Change: K263M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000224400
AA Change: K179M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000224564
AA Change: K263M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a targeted deletion of this gene are detectable only until the blastocyst stage (E3.5) and isolated mutant blastocysts fail to proliferate in vitro. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,248,206	M459K	probably damaging	Het
Adam26a	G	A	8: 43,570,036	T139M	possibly damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Akap9	C	T	5: 3,957,645	Q238*	probably null	Het
Ankrd6	A	T	4: 32,828,774	V85E	probably damaging	Het
Ap2b1	C	A	11: 83,324,604	P125T	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Cblc	A	T	7: 19,790,474	D280E	probably benign	Het
Cdk11b	T	C	4: 155,648,397		probably benign	Het
Cela2a	G	T	4: 141,817,946	F239L	probably damaging	Het
Cfap57	A	T	4: 118,606,631	C342S	probably benign	Het
Clca4a	C	A	3: 144,963,755	W345L	probably damaging	Het
Col6a5	T	C	9: 105,931,293	D852G	unknown	Het
Cyp4a32	T	C	4: 115,611,308	V329A	possibly damaging	Het
Dcaf8	C	T	1: 172,175,495	P287S	probably damaging	Het
Dmxl1	T	A	18: 49,934,637	D2654E	probably damaging	Het
Dpep1	A	T	8: 123,200,747	I347F	possibly damaging	Het
Dtnb	T	A	12: 3,643,936	Y56*	probably null	Het
Duox1	T	C	2: 122,338,644	Y1182H	possibly damaging	Het
Dusp10	T	A	1: 184,037,225	S129R	probably benign	Het
Epcam	G	A	17: 87,642,128	R173Q	probably damaging	Het
Ephb3	A	G	16: 21,220,650	E384G	probably damaging	Het
Exosc10	A	T	4: 148,568,503	D525V	probably damaging	Het
Fam186a	T	A	15: 99,942,346	T2006S	possibly damaging	Het
Fbxw21	T	A	9: 109,148,174	T156S	possibly damaging	Het
Fcrl5	A	G	3: 87,457,397	E568G	probably damaging	Het
Fmn2	C	T	1: 174,608,458		probably benign	Het
Fut9	A	G	4: 25,619,744	F357L	possibly damaging	Het
Gas2l1	G	A	11: 5,064,266	H65Y	probably damaging	Het
Gjd2	A	T	2: 114,013,133	M1K	probably null	Het
Gm12169	T	C	11: 46,526,294	L13P	probably damaging	Het
Gm884	T	A	11: 103,617,071		probably benign	Het
Hdgfl3	T	C	7: 81,899,684	Y149C	probably damaging	Het
Hmcn2	T	C	2: 31,354,721	V730A	probably damaging	Het
Inpp4a	A	T	1: 37,398,799	S223C	probably damaging	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Knl1	T	A	2: 119,071,738	W1307R	probably benign	Het
Kpna3	A	G	14: 61,387,477	L139P	probably damaging	Het
Lama3	T	C	18: 12,479,872		probably null	Het
Lin54	G	A	5: 100,485,249	P192L	possibly damaging	Het
Lpo	T	A	11: 87,809,192		probably null	Het
Lrrd1	T	G	5: 3,850,483		probably null	Het
Nbas	T	A	12: 13,560,977		probably null	Het
Nemp1	G	A	10: 127,696,248	G341D	probably damaging	Het
Nrp1	T	C	8: 128,425,885	F192L	probably damaging	Het
Nufip2	T	A	11: 77,693,090	V610E	probably damaging	Het
Nup160	T	G	2: 90,700,436	Y479*	probably null	Het
Oas1d	A	T	5: 120,919,962	D323V	possibly damaging	Het
Olfr125	A	G	17: 37,835,353	D118G	possibly damaging	Het
Olfr1338	A	G	4: 118,753,600	W315R	possibly damaging	Het
Olfr140	T	C	2: 90,051,784	Y180C	probably damaging	Het
Olfr147	G	A	9: 38,403,254	V127M	possibly damaging	Het
Olfr204	T	A	16: 59,314,706	R234*	probably null	Het
Olfr25	A	T	9: 38,330,507	T307S	probably benign	Het
Olfr677	C	A	7: 105,056,794	H183N	probably damaging	Het
Pcm1	T	A	8: 41,313,359	M1567K	possibly damaging	Het
Pdxk	A	G	10: 78,443,896	V215A	probably benign	Het
Phf12	T	A	11: 78,023,601	L74Q	probably damaging	Het
Plcg1	A	G	2: 160,753,743	E537G	probably null	Het
Plxna2	C	T	1: 194,644,370	P204L	possibly damaging	Het
Ppp3cb	T	G	14: 20,524,063	M236L	probably benign	Het
Qrsl1	A	T	10: 43,896,030	S55T	probably damaging	Het
Rbm5	T	C	9: 107,743,913		probably null	Het
Sipa1l2	A	G	8: 125,444,535	S1403P	probably damaging	Het
Sis	C	T	3: 72,965,604	C67Y	probably damaging	Het
Specc1	A	G	11: 62,128,392	I686V	possibly damaging	Het
Speg	G	A	1: 75,417,863	E1739K	probably benign	Het
Sprtn	C	A	8: 124,901,633	H154Q	probably damaging	Het
St7l	A	G	3: 104,870,987	T147A	probably benign	Het
Stab1	G	A	14: 31,146,028	Q1630*	probably null	Het
Stpg2	A	G	3: 139,232,199	D173G	probably benign	Het
Tcf20	G	A	15: 82,852,777	T1491I	probably benign	Het
Themis2	A	T	4: 132,789,649	I180N	possibly damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	C	T	2: 76,745,634	V24972M	probably damaging	Het
Ttn	A	G	2: 76,807,996	V13980A	probably damaging	Het
Usp5	A	T	6: 124,823,460	M286K	possibly damaging	Het
Vmn2r22	G	A	6: 123,637,843	R263C	possibly damaging	Het
Vmn2r71	T	G	7: 85,621,227	C534G	probably damaging	Het
Wdr60	T	C	12: 116,255,912	I137V	probably benign	Het
Wnk2	C	T	13: 49,060,726	S1460N	possibly damaging	Het
Zfp445	G	A	9: 122,852,642	P745S	probably damaging	Het
Zfp957	C	T	14: 79,213,996	G121D	probably damaging	Het
Zscan4f	A	G	7: 11,401,327	E220G	possibly damaging	Het

Other mutations in A1cf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:A1cf	APN	19	31920951	missense	possibly damaging	0.90
IGL01411:A1cf	APN	19	31911229	missense	possibly damaging	0.94
IGL01445:A1cf	APN	19	31945798	missense	probably benign	0.32
IGL02165:A1cf	APN	19	31927186	missense	possibly damaging	0.92
IGL02543:A1cf	APN	19	31918095	missense	probably damaging	0.97
IGL02651:A1cf	APN	19	31932506	missense	probably benign	0.25
IGL02904:A1cf	APN	19	31934806	missense	probably damaging	1.00
Haywire	UTSW	19	31918124	critical splice donor site	probably null
R0281:A1cf	UTSW	19	31945814	missense	probably benign	0.09
R0349:A1cf	UTSW	19	31932662	missense	possibly damaging	0.62
R0662:A1cf	UTSW	19	31920938	missense	probably benign	0.00
R0697:A1cf	UTSW	19	31911167	missense	probably damaging	1.00
R1055:A1cf	UTSW	19	31932519	missense	probably benign	0.05
R1125:A1cf	UTSW	19	31920978	missense	probably benign	0.00
R1448:A1cf	UTSW	19	31908796	missense	possibly damaging	0.88
R1554:A1cf	UTSW	19	31908902	missense	possibly damaging	0.66
R1616:A1cf	UTSW	19	31934775	missense	probably damaging	0.98
R1660:A1cf	UTSW	19	31893107	nonsense	probably null
R2338:A1cf	UTSW	19	31932545	missense	probably benign
R2435:A1cf	UTSW	19	31920894	missense	probably benign	0.02
R2890:A1cf	UTSW	19	31918017	missense	probably benign	0.05
R3688:A1cf	UTSW	19	31911169	missense	probably damaging	1.00
R4007:A1cf	UTSW	19	31918124	critical splice donor site	probably null
R4208:A1cf	UTSW	19	31932660	missense	probably benign	0.00
R4448:A1cf	UTSW	19	31945862	missense	probably benign
R5072:A1cf	UTSW	19	31917985	missense	probably benign	0.18
R5491:A1cf	UTSW	19	31918062	missense	possibly damaging	0.57
R5636:A1cf	UTSW	19	31944982	nonsense	probably null
R5932:A1cf	UTSW	19	31893118	missense	possibly damaging	0.68
R7066:A1cf	UTSW	19	31927114	missense	probably damaging	0.99
R7211:A1cf	UTSW	19	31927141	missense	probably benign	0.23
R7413:A1cf	UTSW	19	31918124	critical splice donor site	probably null
R7545:A1cf	UTSW	19	31934790	missense	possibly damaging	0.80
R8020:A1cf	UTSW	19	31893194	missense	probably benign	0.01
R8344:A1cf	UTSW	19	31911119	missense	possibly damaging	0.77
R8497:A1cf	UTSW	19	31945850	missense	probably benign
R8989:A1cf	UTSW	19	31927156	missense	possibly damaging	0.56
R9327:A1cf	UTSW	19	31918099	missense	probably benign	0.12
R9436:A1cf	UTSW	19	31932575	missense	probably benign
Z1176:A1cf	UTSW	19	31918017	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- AGACTTCAGCAGCCAGGGGATATAC -3'
(R):5'- AGAGAGCTGGGCTAACATGGACTC -3'

Sequencing Primer
(F):5'- gggatatacccgccCCTC -3'
(R):5'- TAACATGGACTCCAGAGGTTGC -3'

Posted On

2014-05-14