Incidental Mutation 'R1720:Hspa4l'
ID 191357
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Name heat shock protein 4 like
Synonyms Osp94, APG-1, 94kDa
MMRRC Submission 039752-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R1720 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 40699814-40750538 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 40736049 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 578 (K578*)
Ref Sequence ENSEMBL: ENSMUSP00000145468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000204702]
AlphaFold P48722
Predicted Effect probably null
Transcript: ENSMUST00000077083
AA Change: K578*
SMART Domains Protein: ENSMUSP00000076336
Gene: ENSMUSG00000025757
AA Change: K578*

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108086
AA Change: K557*
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757
AA Change: K557*

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203353
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204174
Predicted Effect probably null
Transcript: ENSMUST00000204702
AA Change: K578*
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757
AA Change: K578*

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 A G 12: 84,122,655 (GRCm39) D413G probably benign Het
Actr5 G T 2: 158,478,057 (GRCm39) V476F possibly damaging Het
Adhfe1 G A 1: 9,637,125 (GRCm39) D426N probably benign Het
Adra1a T C 14: 66,875,727 (GRCm39) L234P probably damaging Het
Akap9 G T 5: 4,022,791 (GRCm39) V1207L possibly damaging Het
Anapc2 A G 2: 25,164,724 (GRCm39) D36G probably benign Het
Apol8 A G 15: 77,633,566 (GRCm39) S337P possibly damaging Het
Asxl3 A T 18: 22,585,492 (GRCm39) D139V probably damaging Het
Atp13a4 A T 16: 29,227,746 (GRCm39) V1037E probably damaging Het
Baat A T 4: 49,490,231 (GRCm39) F284L probably benign Het
Bltp3b T C 10: 89,618,448 (GRCm39) V141A probably damaging Het
C1qtnf6 A T 15: 78,411,640 (GRCm39) F40Y probably damaging Het
Caskin2 G A 11: 115,693,608 (GRCm39) H508Y probably damaging Het
Cass4 A T 2: 172,269,654 (GRCm39) I579F probably damaging Het
Cdk15 A G 1: 59,328,917 (GRCm39) Y277C probably damaging Het
Cit G A 5: 116,105,956 (GRCm39) D947N probably damaging Het
Clint1 T A 11: 45,778,237 (GRCm39) I126K probably damaging Het
Col6a4 C T 9: 105,903,671 (GRCm39) G1640E probably damaging Het
Ddx10 T C 9: 53,149,371 (GRCm39) K119E probably damaging Het
Dennd1a G A 2: 37,690,209 (GRCm39) Q964* probably null Het
Dnhd1 T C 7: 105,343,035 (GRCm39) F1460L probably benign Het
Edc3 T C 9: 57,655,462 (GRCm39) probably null Het
Edn1 A G 13: 42,458,826 (GRCm39) E163G probably benign Het
Efl1 A T 7: 82,332,929 (GRCm39) D317V possibly damaging Het
Elapor2 T G 5: 9,478,407 (GRCm39) C424G probably damaging Het
F2 A T 2: 91,459,175 (GRCm39) Y430* probably null Het
Faap100 C T 11: 120,265,407 (GRCm39) V490M probably damaging Het
Fuz G T 7: 44,546,415 (GRCm39) G104W probably damaging Het
Greb1l C A 18: 10,553,848 (GRCm39) H1616Q probably benign Het
Grm1 G T 10: 10,622,538 (GRCm39) probably null Het
Gucy2d G T 7: 98,126,437 (GRCm39) A1098S probably benign Het
H1f0 T A 15: 78,913,195 (GRCm39) S92T possibly damaging Het
Hbb-bt T A 7: 103,463,083 (GRCm39) probably benign Het
Heg1 G A 16: 33,527,549 (GRCm39) A170T probably benign Het
Ikbke A G 1: 131,186,947 (GRCm39) S582P possibly damaging Het
Itga6 T A 2: 71,650,510 (GRCm39) F185L probably damaging Het
Itgal T A 7: 126,906,099 (GRCm39) D396E probably benign Het
Kif5b T C 18: 6,213,427 (GRCm39) H687R probably benign Het
Kmt2c T C 5: 25,504,182 (GRCm39) N3709D probably benign Het
Lipf A T 19: 33,943,066 (GRCm39) K125* probably null Het
Lrif1 A T 3: 106,640,452 (GRCm39) E512D probably damaging Het
Matn2 T A 15: 34,345,420 (GRCm39) Y142* probably null Het
Med13l A G 5: 118,880,060 (GRCm39) T1051A probably damaging Het
Mpp3 T A 11: 101,916,582 (GRCm39) M1L possibly damaging Het
Mro C T 18: 74,009,806 (GRCm39) S159L probably benign Het
Myh15 T A 16: 48,913,145 (GRCm39) D367E probably damaging Het
Myo1g T C 11: 6,462,490 (GRCm39) Q547R probably benign Het
Neb T C 2: 52,097,733 (GRCm39) I902M probably benign Het
Nsd1 G A 13: 55,394,711 (GRCm39) D771N probably damaging Het
Or10x4 A G 1: 174,219,486 (GRCm39) I284V probably benign Het
Or14a256 T C 7: 86,265,664 (GRCm39) N63S probably damaging Het
Or2a20 T C 6: 43,194,494 (GRCm39) S216P probably damaging Het
Or4e5 A C 14: 52,728,051 (GRCm39) Y40* probably null Het
Or8b48 C T 9: 38,492,585 (GRCm39) T4I probably benign Het
Penk A G 4: 4,134,240 (GRCm39) Y136H probably damaging Het
Prdm6 C T 18: 53,673,272 (GRCm39) S144L probably benign Het
Ptprq T A 10: 107,522,155 (GRCm39) I599F probably damaging Het
Racgap1 A T 15: 99,526,650 (GRCm39) C304* probably null Het
Rbp3 T C 14: 33,678,866 (GRCm39) V938A probably benign Het
Rpp30 A G 19: 36,071,827 (GRCm39) K132E probably damaging Het
Rxfp2 A T 5: 149,966,564 (GRCm39) R101* probably null Het
Ryr1 A T 7: 28,801,295 (GRCm39) V823E probably damaging Het
S100pbp A T 4: 129,075,886 (GRCm39) D146E probably damaging Het
Sdr9c7 T A 10: 127,738,127 (GRCm39) V135E probably damaging Het
Serpinb12 A G 1: 106,874,344 (GRCm39) D23G probably damaging Het
Serpinf1 T A 11: 75,304,807 (GRCm39) T185S probably null Het
Slc23a1 A C 18: 35,758,904 (GRCm39) C96G possibly damaging Het
Slc5a4a C T 10: 76,025,103 (GRCm39) probably null Het
Spmap1 A G 11: 97,662,435 (GRCm39) F146L probably damaging Het
Suco A T 1: 161,661,623 (GRCm39) L936Q probably damaging Het
Tmem144 T C 3: 79,732,606 (GRCm39) Y224C probably damaging Het
Tpm4 T A 8: 72,898,598 (GRCm39) probably null Het
Ttn T C 2: 76,560,414 (GRCm39) E29329G probably damaging Het
Txn1 T C 4: 57,943,922 (GRCm39) I101V probably benign Het
Ube2o A T 11: 116,435,433 (GRCm39) C452S probably benign Het
Uxs1 A T 1: 43,804,081 (GRCm39) I278N probably damaging Het
Vps54 T C 11: 21,256,519 (GRCm39) F663L probably damaging Het
Wdfy3 CG C 5: 102,074,391 (GRCm39) probably null Het
Zc3h11a A G 1: 133,549,439 (GRCm39) S741P probably damaging Het
Zdbf2 G A 1: 63,342,436 (GRCm39) V272I possibly damaging Het
Zdhhc24 A G 19: 4,928,979 (GRCm39) N68S probably damaging Het
Znfx1 A T 2: 166,885,986 (GRCm39) L858* probably null Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40,707,657 (GRCm39) nonsense probably null
IGL02605:Hspa4l APN 3 40,736,055 (GRCm39) missense probably benign 0.20
IGL02719:Hspa4l APN 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40,739,840 (GRCm39) splice site probably benign
R0398:Hspa4l UTSW 3 40,711,429 (GRCm39) splice site probably benign
R0487:Hspa4l UTSW 3 40,738,758 (GRCm39) missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40,733,832 (GRCm39) missense probably benign 0.01
R0760:Hspa4l UTSW 3 40,739,155 (GRCm39) nonsense probably null
R1491:Hspa4l UTSW 3 40,741,226 (GRCm39) missense probably benign 0.00
R1984:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40,739,821 (GRCm39) missense probably benign 0.29
R3874:Hspa4l UTSW 3 40,727,074 (GRCm39) missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40,736,026 (GRCm39) missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40,700,435 (GRCm39) missense probably benign 0.03
R4364:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4365:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4366:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4493:Hspa4l UTSW 3 40,722,434 (GRCm39) missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40,707,636 (GRCm39) missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40,739,832 (GRCm39) critical splice donor site probably null
R4994:Hspa4l UTSW 3 40,700,081 (GRCm39) utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40,700,197 (GRCm39) missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40,741,179 (GRCm39) missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40,736,001 (GRCm39) missense probably benign 0.17
R5440:Hspa4l UTSW 3 40,736,008 (GRCm39) missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40,700,177 (GRCm39) missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40,722,411 (GRCm39) missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40,736,031 (GRCm39) missense probably benign 0.09
R6515:Hspa4l UTSW 3 40,736,014 (GRCm39) missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40,711,487 (GRCm39) missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40,736,024 (GRCm39) missense probably benign 0.00
R7601:Hspa4l UTSW 3 40,738,788 (GRCm39) critical splice donor site probably null
R8072:Hspa4l UTSW 3 40,741,178 (GRCm39) missense probably damaging 0.98
R9103:Hspa4l UTSW 3 40,715,349 (GRCm39) critical splice donor site probably null
R9146:Hspa4l UTSW 3 40,736,101 (GRCm39) missense probably benign 0.15
R9762:Hspa4l UTSW 3 40,727,057 (GRCm39) missense probably benign 0.01
Z1088:Hspa4l UTSW 3 40,721,425 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCATGGGGgtggtactggaaa -3'
(R):5'- GGGGTGTTAAGAGTTCGCTTCAGAA -3'

Sequencing Primer
(F):5'- tccaggcaagcactttactac -3'
(R):5'- AGGCTTTTTTCTCTAAAGTAGACAC -3'
Posted On 2014-05-14