Incidental Mutation 'R1720:Ryr1'
ID 191373
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Name ryanodine receptor 1, skeletal muscle
Synonyms calcium release channel isoform 1, Ryr, skrr
MMRRC Submission 039752-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1720 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 28702765-28824599 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 28801295 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 823 (V823E)
Ref Sequence ENSEMBL: ENSMUSP00000149042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032813
AA Change: V816E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: V816E

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179893
AA Change: V816E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: V816E

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214374
AA Change: V823E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 A G 12: 84,122,655 (GRCm39) D413G probably benign Het
Actr5 G T 2: 158,478,057 (GRCm39) V476F possibly damaging Het
Adhfe1 G A 1: 9,637,125 (GRCm39) D426N probably benign Het
Adra1a T C 14: 66,875,727 (GRCm39) L234P probably damaging Het
Akap9 G T 5: 4,022,791 (GRCm39) V1207L possibly damaging Het
Anapc2 A G 2: 25,164,724 (GRCm39) D36G probably benign Het
Apol8 A G 15: 77,633,566 (GRCm39) S337P possibly damaging Het
Asxl3 A T 18: 22,585,492 (GRCm39) D139V probably damaging Het
Atp13a4 A T 16: 29,227,746 (GRCm39) V1037E probably damaging Het
Baat A T 4: 49,490,231 (GRCm39) F284L probably benign Het
Bltp3b T C 10: 89,618,448 (GRCm39) V141A probably damaging Het
C1qtnf6 A T 15: 78,411,640 (GRCm39) F40Y probably damaging Het
Caskin2 G A 11: 115,693,608 (GRCm39) H508Y probably damaging Het
Cass4 A T 2: 172,269,654 (GRCm39) I579F probably damaging Het
Cdk15 A G 1: 59,328,917 (GRCm39) Y277C probably damaging Het
Cit G A 5: 116,105,956 (GRCm39) D947N probably damaging Het
Clint1 T A 11: 45,778,237 (GRCm39) I126K probably damaging Het
Col6a4 C T 9: 105,903,671 (GRCm39) G1640E probably damaging Het
Ddx10 T C 9: 53,149,371 (GRCm39) K119E probably damaging Het
Dennd1a G A 2: 37,690,209 (GRCm39) Q964* probably null Het
Dnhd1 T C 7: 105,343,035 (GRCm39) F1460L probably benign Het
Edc3 T C 9: 57,655,462 (GRCm39) probably null Het
Edn1 A G 13: 42,458,826 (GRCm39) E163G probably benign Het
Efl1 A T 7: 82,332,929 (GRCm39) D317V possibly damaging Het
Elapor2 T G 5: 9,478,407 (GRCm39) C424G probably damaging Het
F2 A T 2: 91,459,175 (GRCm39) Y430* probably null Het
Faap100 C T 11: 120,265,407 (GRCm39) V490M probably damaging Het
Fuz G T 7: 44,546,415 (GRCm39) G104W probably damaging Het
Greb1l C A 18: 10,553,848 (GRCm39) H1616Q probably benign Het
Grm1 G T 10: 10,622,538 (GRCm39) probably null Het
Gucy2d G T 7: 98,126,437 (GRCm39) A1098S probably benign Het
H1f0 T A 15: 78,913,195 (GRCm39) S92T possibly damaging Het
Hbb-bt T A 7: 103,463,083 (GRCm39) probably benign Het
Heg1 G A 16: 33,527,549 (GRCm39) A170T probably benign Het
Hspa4l A T 3: 40,736,049 (GRCm39) K578* probably null Het
Ikbke A G 1: 131,186,947 (GRCm39) S582P possibly damaging Het
Itga6 T A 2: 71,650,510 (GRCm39) F185L probably damaging Het
Itgal T A 7: 126,906,099 (GRCm39) D396E probably benign Het
Kif5b T C 18: 6,213,427 (GRCm39) H687R probably benign Het
Kmt2c T C 5: 25,504,182 (GRCm39) N3709D probably benign Het
Lipf A T 19: 33,943,066 (GRCm39) K125* probably null Het
Lrif1 A T 3: 106,640,452 (GRCm39) E512D probably damaging Het
Matn2 T A 15: 34,345,420 (GRCm39) Y142* probably null Het
Med13l A G 5: 118,880,060 (GRCm39) T1051A probably damaging Het
Mpp3 T A 11: 101,916,582 (GRCm39) M1L possibly damaging Het
Mro C T 18: 74,009,806 (GRCm39) S159L probably benign Het
Myh15 T A 16: 48,913,145 (GRCm39) D367E probably damaging Het
Myo1g T C 11: 6,462,490 (GRCm39) Q547R probably benign Het
Neb T C 2: 52,097,733 (GRCm39) I902M probably benign Het
Nsd1 G A 13: 55,394,711 (GRCm39) D771N probably damaging Het
Or10x4 A G 1: 174,219,486 (GRCm39) I284V probably benign Het
Or14a256 T C 7: 86,265,664 (GRCm39) N63S probably damaging Het
Or2a20 T C 6: 43,194,494 (GRCm39) S216P probably damaging Het
Or4e5 A C 14: 52,728,051 (GRCm39) Y40* probably null Het
Or8b48 C T 9: 38,492,585 (GRCm39) T4I probably benign Het
Penk A G 4: 4,134,240 (GRCm39) Y136H probably damaging Het
Prdm6 C T 18: 53,673,272 (GRCm39) S144L probably benign Het
Ptprq T A 10: 107,522,155 (GRCm39) I599F probably damaging Het
Racgap1 A T 15: 99,526,650 (GRCm39) C304* probably null Het
Rbp3 T C 14: 33,678,866 (GRCm39) V938A probably benign Het
Rpp30 A G 19: 36,071,827 (GRCm39) K132E probably damaging Het
Rxfp2 A T 5: 149,966,564 (GRCm39) R101* probably null Het
S100pbp A T 4: 129,075,886 (GRCm39) D146E probably damaging Het
Sdr9c7 T A 10: 127,738,127 (GRCm39) V135E probably damaging Het
Serpinb12 A G 1: 106,874,344 (GRCm39) D23G probably damaging Het
Serpinf1 T A 11: 75,304,807 (GRCm39) T185S probably null Het
Slc23a1 A C 18: 35,758,904 (GRCm39) C96G possibly damaging Het
Slc5a4a C T 10: 76,025,103 (GRCm39) probably null Het
Spmap1 A G 11: 97,662,435 (GRCm39) F146L probably damaging Het
Suco A T 1: 161,661,623 (GRCm39) L936Q probably damaging Het
Tmem144 T C 3: 79,732,606 (GRCm39) Y224C probably damaging Het
Tpm4 T A 8: 72,898,598 (GRCm39) probably null Het
Ttn T C 2: 76,560,414 (GRCm39) E29329G probably damaging Het
Txn1 T C 4: 57,943,922 (GRCm39) I101V probably benign Het
Ube2o A T 11: 116,435,433 (GRCm39) C452S probably benign Het
Uxs1 A T 1: 43,804,081 (GRCm39) I278N probably damaging Het
Vps54 T C 11: 21,256,519 (GRCm39) F663L probably damaging Het
Wdfy3 CG C 5: 102,074,391 (GRCm39) probably null Het
Zc3h11a A G 1: 133,549,439 (GRCm39) S741P probably damaging Het
Zdbf2 G A 1: 63,342,436 (GRCm39) V272I possibly damaging Het
Zdhhc24 A G 19: 4,928,979 (GRCm39) N68S probably damaging Het
Znfx1 A T 2: 166,885,986 (GRCm39) L858* probably null Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 28,802,235 (GRCm39) missense probably damaging 1.00
IGL00335:Ryr1 APN 7 28,824,385 (GRCm39) splice site probably null
IGL00427:Ryr1 APN 7 28,804,162 (GRCm39) splice site probably benign
IGL00559:Ryr1 APN 7 28,711,667 (GRCm39) splice site probably benign
IGL00803:Ryr1 APN 7 28,769,070 (GRCm39) missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 28,723,654 (GRCm39) missense probably damaging 1.00
IGL00948:Ryr1 APN 7 28,719,620 (GRCm39) missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 28,781,968 (GRCm39) missense probably damaging 0.99
IGL01116:Ryr1 APN 7 28,799,627 (GRCm39) splice site probably benign
IGL01385:Ryr1 APN 7 28,756,410 (GRCm39) missense probably damaging 1.00
IGL01482:Ryr1 APN 7 28,751,762 (GRCm39) missense probably damaging 1.00
IGL01529:Ryr1 APN 7 28,774,652 (GRCm39) missense probably damaging 1.00
IGL01543:Ryr1 APN 7 28,790,501 (GRCm39) missense probably damaging 1.00
IGL01653:Ryr1 APN 7 28,778,022 (GRCm39) missense probably damaging 0.99
IGL01701:Ryr1 APN 7 28,759,235 (GRCm39) missense probably damaging 0.98
IGL02051:Ryr1 APN 7 28,771,083 (GRCm39) missense probably benign 0.16
IGL02152:Ryr1 APN 7 28,751,440 (GRCm39) missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 28,793,472 (GRCm39) missense probably benign 0.07
IGL02321:Ryr1 APN 7 28,778,121 (GRCm39) missense probably damaging 1.00
IGL02448:Ryr1 APN 7 28,804,491 (GRCm39) splice site probably benign
IGL02472:Ryr1 APN 7 28,740,269 (GRCm39) missense probably damaging 1.00
IGL02544:Ryr1 APN 7 28,815,024 (GRCm39) missense probably benign 0.24
IGL02666:Ryr1 APN 7 28,719,188 (GRCm39) missense unknown
IGL02672:Ryr1 APN 7 28,703,944 (GRCm39) unclassified probably benign
IGL02677:Ryr1 APN 7 28,810,033 (GRCm39) missense probably benign 0.18
IGL02686:Ryr1 APN 7 28,768,975 (GRCm39) splice site probably benign
IGL02751:Ryr1 APN 7 28,778,199 (GRCm39) missense probably damaging 1.00
IGL02899:Ryr1 APN 7 28,748,220 (GRCm39) missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 28,760,965 (GRCm39) missense probably damaging 1.00
IGL02950:Ryr1 APN 7 28,796,884 (GRCm39) missense probably damaging 1.00
IGL02960:Ryr1 APN 7 28,759,478 (GRCm39) missense probably damaging 1.00
IGL02968:Ryr1 APN 7 28,743,318 (GRCm39) missense probably damaging 1.00
IGL03070:Ryr1 APN 7 28,770,084 (GRCm39) missense probably damaging 1.00
IGL03091:Ryr1 APN 7 28,782,911 (GRCm39) missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 28,804,018 (GRCm39) missense probably damaging 1.00
IGL03107:Ryr1 APN 7 28,774,624 (GRCm39) missense probably damaging 1.00
IGL03117:Ryr1 APN 7 28,802,389 (GRCm39) missense probably damaging 1.00
IGL03118:Ryr1 APN 7 28,715,211 (GRCm39) missense unknown
IGL03146:Ryr1 APN 7 28,793,457 (GRCm39) missense probably benign 0.09
IGL03165:Ryr1 APN 7 28,804,465 (GRCm39) missense probably benign 0.22
IGL03220:Ryr1 APN 7 28,759,280 (GRCm39) missense probably damaging 1.00
R0017:Ryr1 UTSW 7 28,746,967 (GRCm39) missense probably damaging 1.00
R0066:Ryr1 UTSW 7 28,704,992 (GRCm39) unclassified probably benign
R0066:Ryr1 UTSW 7 28,704,992 (GRCm39) unclassified probably benign
R0069:Ryr1 UTSW 7 28,809,930 (GRCm39) splice site probably benign
R0148:Ryr1 UTSW 7 28,751,460 (GRCm39) missense probably damaging 0.99
R0266:Ryr1 UTSW 7 28,740,104 (GRCm39) missense probably damaging 1.00
R0346:Ryr1 UTSW 7 28,767,013 (GRCm39) splice site probably benign
R0387:Ryr1 UTSW 7 28,782,792 (GRCm39) splice site probably benign
R0454:Ryr1 UTSW 7 28,735,500 (GRCm39) missense probably damaging 0.99
R0494:Ryr1 UTSW 7 28,703,218 (GRCm39) splice site probably benign
R0533:Ryr1 UTSW 7 28,778,205 (GRCm39) missense probably damaging 1.00
R0585:Ryr1 UTSW 7 28,735,501 (GRCm39) missense probably damaging 1.00
R0591:Ryr1 UTSW 7 28,804,220 (GRCm39) missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 28,774,034 (GRCm39) missense probably damaging 1.00
R0662:Ryr1 UTSW 7 28,799,614 (GRCm39) missense probably damaging 1.00
R0849:Ryr1 UTSW 7 28,740,104 (GRCm39) missense probably damaging 1.00
R0961:Ryr1 UTSW 7 28,709,122 (GRCm39) missense unknown
R1052:Ryr1 UTSW 7 28,795,683 (GRCm39) missense probably damaging 0.96
R1218:Ryr1 UTSW 7 28,785,534 (GRCm39) missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 28,815,437 (GRCm39) missense probably damaging 0.99
R1513:Ryr1 UTSW 7 28,770,046 (GRCm39) missense probably damaging 1.00
R1543:Ryr1 UTSW 7 28,782,962 (GRCm39) missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 28,791,600 (GRCm39) missense possibly damaging 0.95
R1572:Ryr1 UTSW 7 28,761,616 (GRCm39) missense probably damaging 1.00
R1623:Ryr1 UTSW 7 28,794,915 (GRCm39) missense probably damaging 1.00
R1632:Ryr1 UTSW 7 28,793,686 (GRCm39) missense probably benign 0.03
R1661:Ryr1 UTSW 7 28,801,163 (GRCm39) missense probably damaging 0.98
R1665:Ryr1 UTSW 7 28,735,503 (GRCm39) missense probably damaging 1.00
R1678:Ryr1 UTSW 7 28,815,579 (GRCm39) missense probably damaging 0.99
R1705:Ryr1 UTSW 7 28,777,989 (GRCm39) missense probably damaging 1.00
R1712:Ryr1 UTSW 7 28,746,928 (GRCm39) missense probably benign 0.25
R1799:Ryr1 UTSW 7 28,767,046 (GRCm39) missense probably damaging 1.00
R1847:Ryr1 UTSW 7 28,779,236 (GRCm39) missense probably benign 0.43
R1860:Ryr1 UTSW 7 28,708,977 (GRCm39) missense unknown
R1861:Ryr1 UTSW 7 28,708,977 (GRCm39) missense unknown
R1921:Ryr1 UTSW 7 28,754,369 (GRCm39) missense probably damaging 1.00
R1983:Ryr1 UTSW 7 28,758,897 (GRCm39) missense possibly damaging 0.74
R2043:Ryr1 UTSW 7 28,759,056 (GRCm39) missense probably damaging 0.99
R2089:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2091:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2091:Ryr1 UTSW 7 28,785,474 (GRCm39) missense probably damaging 1.00
R2105:Ryr1 UTSW 7 28,789,575 (GRCm39) missense probably damaging 0.99
R2175:Ryr1 UTSW 7 28,767,867 (GRCm39) missense probably damaging 1.00
R2259:Ryr1 UTSW 7 28,719,166 (GRCm39) missense unknown
R2291:Ryr1 UTSW 7 28,798,202 (GRCm39) missense probably damaging 1.00
R2351:Ryr1 UTSW 7 28,774,718 (GRCm39) missense probably benign 0.18
R2512:Ryr1 UTSW 7 28,802,967 (GRCm39) missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 28,735,551 (GRCm39) missense possibly damaging 0.94
R2571:Ryr1 UTSW 7 28,708,987 (GRCm39) missense unknown
R2885:Ryr1 UTSW 7 28,774,223 (GRCm39) missense probably damaging 0.99
R2886:Ryr1 UTSW 7 28,774,223 (GRCm39) missense probably damaging 0.99
R2889:Ryr1 UTSW 7 28,778,166 (GRCm39) missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3052:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3053:Ryr1 UTSW 7 28,752,515 (GRCm39) missense probably damaging 1.00
R3082:Ryr1 UTSW 7 28,745,071 (GRCm39) missense probably damaging 1.00
R3103:Ryr1 UTSW 7 28,774,373 (GRCm39) missense probably damaging 1.00
R3237:Ryr1 UTSW 7 28,769,075 (GRCm39) critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 28,756,422 (GRCm39) missense probably damaging 1.00
R3552:Ryr1 UTSW 7 28,756,422 (GRCm39) missense probably damaging 1.00
R3807:Ryr1 UTSW 7 28,719,577 (GRCm39) missense probably damaging 1.00
R3815:Ryr1 UTSW 7 28,772,327 (GRCm39) missense probably damaging 0.98
R4010:Ryr1 UTSW 7 28,794,549 (GRCm39) missense probably benign 0.41
R4041:Ryr1 UTSW 7 28,785,356 (GRCm39) missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 28,761,576 (GRCm39) nonsense probably null
R4257:Ryr1 UTSW 7 28,781,875 (GRCm39) missense possibly damaging 0.93
R4328:Ryr1 UTSW 7 28,782,484 (GRCm39) missense probably damaging 1.00
R4394:Ryr1 UTSW 7 28,793,667 (GRCm39) missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 28,789,581 (GRCm39) missense probably damaging 0.97
R4550:Ryr1 UTSW 7 28,798,160 (GRCm39) missense probably benign 0.05
R4554:Ryr1 UTSW 7 28,804,433 (GRCm39) missense probably benign 0.03
R4562:Ryr1 UTSW 7 28,774,005 (GRCm39) intron probably benign
R4642:Ryr1 UTSW 7 28,785,463 (GRCm39) missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 28,759,256 (GRCm39) missense probably null 0.99
R4707:Ryr1 UTSW 7 28,745,087 (GRCm39) missense probably damaging 1.00
R4766:Ryr1 UTSW 7 28,785,258 (GRCm39) missense probably damaging 0.96
R4768:Ryr1 UTSW 7 28,704,246 (GRCm39) unclassified probably benign
R4770:Ryr1 UTSW 7 28,808,707 (GRCm39) missense probably damaging 0.99
R4780:Ryr1 UTSW 7 28,794,522 (GRCm39) missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 28,719,408 (GRCm39) missense unknown
R4933:Ryr1 UTSW 7 28,803,723 (GRCm39) missense probably damaging 1.00
R4934:Ryr1 UTSW 7 28,767,520 (GRCm39) missense probably damaging 1.00
R4942:Ryr1 UTSW 7 28,768,998 (GRCm39) missense probably damaging 0.98
R4960:Ryr1 UTSW 7 28,778,208 (GRCm39) missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 28,768,540 (GRCm39) missense probably damaging 1.00
R5011:Ryr1 UTSW 7 28,802,234 (GRCm39) splice site probably null
R5013:Ryr1 UTSW 7 28,802,234 (GRCm39) splice site probably null
R5137:Ryr1 UTSW 7 28,801,283 (GRCm39) missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 28,767,118 (GRCm39) missense probably damaging 1.00
R5239:Ryr1 UTSW 7 28,735,553 (GRCm39) missense probably damaging 1.00
R5291:Ryr1 UTSW 7 28,815,023 (GRCm39) missense probably benign 0.03
R5303:Ryr1 UTSW 7 28,767,907 (GRCm39) missense probably damaging 1.00
R5386:Ryr1 UTSW 7 28,816,841 (GRCm39) missense probably damaging 0.98
R5431:Ryr1 UTSW 7 28,809,237 (GRCm39) missense probably benign 0.39
R5460:Ryr1 UTSW 7 28,771,386 (GRCm39) missense probably damaging 1.00
R5463:Ryr1 UTSW 7 28,723,448 (GRCm39) missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 28,768,453 (GRCm39) missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 28,785,610 (GRCm39) missense probably damaging 1.00
R5573:Ryr1 UTSW 7 28,715,148 (GRCm39) missense unknown
R5575:Ryr1 UTSW 7 28,778,118 (GRCm39) missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 28,811,399 (GRCm39) missense probably benign 0.05
R5658:Ryr1 UTSW 7 28,790,514 (GRCm39) splice site probably null
R5918:Ryr1 UTSW 7 28,708,577 (GRCm39) missense probably benign 0.39
R5926:Ryr1 UTSW 7 28,803,785 (GRCm39) missense probably damaging 1.00
R5938:Ryr1 UTSW 7 28,746,290 (GRCm39) missense probably damaging 1.00
R5939:Ryr1 UTSW 7 28,815,552 (GRCm39) missense probably damaging 0.97
R5947:Ryr1 UTSW 7 28,771,349 (GRCm39) missense probably null 0.98
R5991:Ryr1 UTSW 7 28,804,035 (GRCm39) missense probably damaging 0.99
R5992:Ryr1 UTSW 7 28,767,062 (GRCm39) missense probably damaging 1.00
R5996:Ryr1 UTSW 7 28,723,666 (GRCm39) missense probably benign 0.38
R6075:Ryr1 UTSW 7 28,786,863 (GRCm39) missense probably damaging 1.00
R6091:Ryr1 UTSW 7 28,771,398 (GRCm39) missense probably benign 0.01
R6126:Ryr1 UTSW 7 28,775,664 (GRCm39) missense probably null 1.00
R6147:Ryr1 UTSW 7 28,785,339 (GRCm39) missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 28,815,606 (GRCm39) missense probably benign 0.07
R6279:Ryr1 UTSW 7 28,786,853 (GRCm39) missense possibly damaging 0.93
R6381:Ryr1 UTSW 7 28,774,682 (GRCm39) missense possibly damaging 0.87
R6441:Ryr1 UTSW 7 28,759,120 (GRCm39) missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 28,776,503 (GRCm39) missense probably damaging 0.97
R6459:Ryr1 UTSW 7 28,715,079 (GRCm39) missense probably benign 0.39
R6514:Ryr1 UTSW 7 28,746,266 (GRCm39) missense probably damaging 1.00
R6563:Ryr1 UTSW 7 28,794,917 (GRCm39) missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 28,737,770 (GRCm39) critical splice donor site probably null
R6746:Ryr1 UTSW 7 28,816,829 (GRCm39) missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 28,764,299 (GRCm39) missense probably benign 0.12
R6800:Ryr1 UTSW 7 28,723,741 (GRCm39) missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 28,751,751 (GRCm39) missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 28,808,812 (GRCm39) missense probably benign 0.03
R6995:Ryr1 UTSW 7 28,793,607 (GRCm39) missense probably damaging 0.97
R7065:Ryr1 UTSW 7 28,803,068 (GRCm39) missense probably damaging 1.00
R7123:Ryr1 UTSW 7 28,746,279 (GRCm39) missense probably benign 0.37
R7238:Ryr1 UTSW 7 28,794,807 (GRCm39) missense probably benign 0.24
R7240:Ryr1 UTSW 7 28,751,440 (GRCm39) missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 28,758,936 (GRCm39) missense probably damaging 1.00
R7365:Ryr1 UTSW 7 28,785,180 (GRCm39) missense probably benign 0.05
R7403:Ryr1 UTSW 7 28,713,292 (GRCm39) missense probably benign 0.34
R7422:Ryr1 UTSW 7 28,785,295 (GRCm39) missense probably benign 0.00
R7493:Ryr1 UTSW 7 28,794,630 (GRCm39) missense probably benign 0.44
R7570:Ryr1 UTSW 7 28,778,010 (GRCm39) missense probably damaging 0.98
R7593:Ryr1 UTSW 7 28,735,528 (GRCm39) missense probably damaging 1.00
R7769:Ryr1 UTSW 7 28,798,210 (GRCm39) missense probably damaging 1.00
R7781:Ryr1 UTSW 7 28,767,055 (GRCm39) missense probably damaging 1.00
R7790:Ryr1 UTSW 7 28,804,257 (GRCm39) missense probably benign 0.39
R7799:Ryr1 UTSW 7 28,702,985 (GRCm39) splice site probably null
R7916:Ryr1 UTSW 7 28,790,364 (GRCm39) nonsense probably null
R7922:Ryr1 UTSW 7 28,796,649 (GRCm39) missense probably benign 0.09
R7988:Ryr1 UTSW 7 28,795,596 (GRCm39) missense probably benign 0.29
R7997:Ryr1 UTSW 7 28,702,968 (GRCm39) missense unknown
R8052:Ryr1 UTSW 7 28,782,810 (GRCm39) missense probably benign 0.05
R8096:Ryr1 UTSW 7 28,708,626 (GRCm39) missense unknown
R8116:Ryr1 UTSW 7 28,810,308 (GRCm39) missense probably benign 0.03
R8202:Ryr1 UTSW 7 28,790,457 (GRCm39) missense probably benign 0.18
R8207:Ryr1 UTSW 7 28,789,650 (GRCm39) missense probably damaging 1.00
R8248:Ryr1 UTSW 7 28,768,546 (GRCm39) missense probably damaging 1.00
R8257:Ryr1 UTSW 7 28,764,064 (GRCm39) missense possibly damaging 0.82
R8354:Ryr1 UTSW 7 28,715,142 (GRCm39) missense unknown
R8454:Ryr1 UTSW 7 28,715,142 (GRCm39) missense unknown
R8487:Ryr1 UTSW 7 28,740,292 (GRCm39) missense probably damaging 0.97
R8529:Ryr1 UTSW 7 28,769,509 (GRCm39) missense possibly damaging 0.86
R8545:Ryr1 UTSW 7 28,704,239 (GRCm39) unclassified probably benign
R8678:Ryr1 UTSW 7 28,776,489 (GRCm39) missense probably damaging 0.99
R8717:Ryr1 UTSW 7 28,751,753 (GRCm39) missense probably benign 0.03
R8724:Ryr1 UTSW 7 28,816,802 (GRCm39) missense probably benign 0.04
R8755:Ryr1 UTSW 7 28,791,693 (GRCm39) missense probably benign 0.19
R8772:Ryr1 UTSW 7 28,815,557 (GRCm39) missense probably benign 0.05
R8790:Ryr1 UTSW 7 28,776,297 (GRCm39) missense probably damaging 1.00
R8793:Ryr1 UTSW 7 28,764,284 (GRCm39) missense probably damaging 1.00
R8836:Ryr1 UTSW 7 28,774,091 (GRCm39) missense probably damaging 1.00
R8858:Ryr1 UTSW 7 28,808,638 (GRCm39) missense probably benign 0.00
R8910:Ryr1 UTSW 7 28,771,340 (GRCm39) missense probably damaging 1.00
R8920:Ryr1 UTSW 7 28,789,640 (GRCm39) missense possibly damaging 0.89
R8938:Ryr1 UTSW 7 28,801,358 (GRCm39) missense probably damaging 1.00
R9035:Ryr1 UTSW 7 28,790,422 (GRCm39) missense probably damaging 0.97
R9115:Ryr1 UTSW 7 28,803,989 (GRCm39) nonsense probably null
R9123:Ryr1 UTSW 7 28,771,229 (GRCm39) missense probably damaging 1.00
R9154:Ryr1 UTSW 7 28,769,283 (GRCm39) missense probably benign 0.08
R9189:Ryr1 UTSW 7 28,776,471 (GRCm39) missense probably damaging 1.00
R9200:Ryr1 UTSW 7 28,794,524 (GRCm39) missense probably benign 0.00
R9214:Ryr1 UTSW 7 28,785,187 (GRCm39) missense possibly damaging 0.52
R9216:Ryr1 UTSW 7 28,801,277 (GRCm39) missense probably damaging 0.97
R9240:Ryr1 UTSW 7 28,743,313 (GRCm39) missense probably damaging 1.00
R9261:Ryr1 UTSW 7 28,751,813 (GRCm39) missense possibly damaging 0.91
R9276:Ryr1 UTSW 7 28,802,254 (GRCm39) missense probably damaging 0.99
R9280:Ryr1 UTSW 7 28,802,389 (GRCm39) missense probably damaging 1.00
R9316:Ryr1 UTSW 7 28,717,387 (GRCm39) missense unknown
R9333:Ryr1 UTSW 7 28,774,214 (GRCm39) critical splice donor site probably null
R9459:Ryr1 UTSW 7 28,768,068 (GRCm39) missense probably damaging 1.00
R9468:Ryr1 UTSW 7 28,772,510 (GRCm39) missense probably damaging 1.00
R9486:Ryr1 UTSW 7 28,777,965 (GRCm39) missense probably benign 0.15
R9524:Ryr1 UTSW 7 28,723,600 (GRCm39) missense probably damaging 1.00
R9620:Ryr1 UTSW 7 28,715,138 (GRCm39) missense unknown
R9664:Ryr1 UTSW 7 28,759,092 (GRCm39) missense probably damaging 1.00
R9776:Ryr1 UTSW 7 28,774,664 (GRCm39) missense probably damaging 1.00
X0021:Ryr1 UTSW 7 28,760,956 (GRCm39) missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 28,802,923 (GRCm39) missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 28,785,460 (GRCm39) missense probably benign 0.10
Z1176:Ryr1 UTSW 7 28,719,639 (GRCm39) missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 28,801,347 (GRCm39) missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 28,748,217 (GRCm39) nonsense probably null
Z1177:Ryr1 UTSW 7 28,717,410 (GRCm39) missense unknown
Z1186:Ryr1 UTSW 7 28,781,902 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AAAACCCTTGCAGAGCTGGTGG -3'
(R):5'- AGAGTCCCCGTGATGGTCTAATGAG -3'

Sequencing Primer
(F):5'- GTACCTGGATGGTGTCCACAG -3'
(R):5'- tcagggagacagagccaag -3'
Posted On 2014-05-14