Incidental Mutation 'R1720:Col6a4'
ID 191385
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Name collagen, type VI, alpha 4
Synonyms Vwa6, 1110001D15Rik, EG235580, Dvwa
MMRRC Submission 039752-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1720 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 105989454-106096783 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 106026472 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 1640 (G1640E)
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
AlphaFold A2AX52
Predicted Effect probably damaging
Transcript: ENSMUST00000121963
AA Change: G1640E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: G1640E

signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,609 F146L probably damaging Het
9330182L06Rik T G 5: 9,428,407 C424G probably damaging Het
Acot5 A G 12: 84,075,881 D413G probably benign Het
Actr5 G T 2: 158,636,137 V476F possibly damaging Het
Adhfe1 G A 1: 9,566,900 D426N probably benign Het
Adra1a T C 14: 66,638,278 L234P probably damaging Het
Akap9 G T 5: 3,972,791 V1207L possibly damaging Het
Anapc2 A G 2: 25,274,712 D36G probably benign Het
Apol8 A G 15: 77,749,366 S337P possibly damaging Het
Asxl3 A T 18: 22,452,435 D139V probably damaging Het
Atp13a4 A T 16: 29,408,928 V1037E probably damaging Het
Baat A T 4: 49,490,231 F284L probably benign Het
C1qtnf6 A T 15: 78,527,440 F40Y probably damaging Het
Caskin2 G A 11: 115,802,782 H508Y probably damaging Het
Cass4 A T 2: 172,427,734 I579F probably damaging Het
Cdk15 A G 1: 59,289,758 Y277C probably damaging Het
Cit G A 5: 115,967,897 D947N probably damaging Het
Clint1 T A 11: 45,887,410 I126K probably damaging Het
Ddx10 T C 9: 53,238,071 K119E probably damaging Het
Dennd1a G A 2: 37,800,197 Q964* probably null Het
Dnhd1 T C 7: 105,693,828 F1460L probably benign Het
Edc3 T C 9: 57,748,179 probably null Het
Edn1 A G 13: 42,305,350 E163G probably benign Het
Efl1 A T 7: 82,683,721 D317V possibly damaging Het
F2 A T 2: 91,628,830 Y430* probably null Het
Faap100 C T 11: 120,374,581 V490M probably damaging Het
Fuz G T 7: 44,896,991 G104W probably damaging Het
Greb1l C A 18: 10,553,848 H1616Q probably benign Het
Grm1 G T 10: 10,746,794 probably null Het
Gucy2d G T 7: 98,477,230 A1098S probably benign Het
H1f0 T A 15: 79,028,995 S92T possibly damaging Het
Hbb-bt T A 7: 103,813,876 probably benign Het
Heg1 G A 16: 33,707,179 A170T probably benign Het
Hspa4l A T 3: 40,781,617 K578* probably null Het
Ikbke A G 1: 131,259,210 S582P possibly damaging Het
Itga6 T A 2: 71,820,166 F185L probably damaging Het
Itgal T A 7: 127,306,927 D396E probably benign Het
Kif5b T C 18: 6,213,427 H687R probably benign Het
Kmt2c T C 5: 25,299,184 N3709D probably benign Het
Lipf A T 19: 33,965,666 K125* probably null Het
Lrif1 A T 3: 106,733,136 E512D probably damaging Het
Matn2 T A 15: 34,345,274 Y142* probably null Het
Med13l A G 5: 118,741,995 T1051A probably damaging Het
Mpp3 T A 11: 102,025,756 M1L possibly damaging Het
Mro C T 18: 73,876,735 S159L probably benign Het
Myh15 T A 16: 49,092,782 D367E probably damaging Het
Myo1g T C 11: 6,512,490 Q547R probably benign Het
Neb T C 2: 52,207,721 I902M probably benign Het
Nsd1 G A 13: 55,246,898 D771N probably damaging Het
Olfr1507 A C 14: 52,490,594 Y40* probably null Het
Olfr248 A G 1: 174,391,920 I284V probably benign Het
Olfr294 T C 7: 86,616,456 N63S probably damaging Het
Olfr434 T C 6: 43,217,560 S216P probably damaging Het
Olfr912 C T 9: 38,581,289 T4I probably benign Het
Penk A G 4: 4,134,240 Y136H probably damaging Het
Prdm6 C T 18: 53,540,200 S144L probably benign Het
Ptprq T A 10: 107,686,294 I599F probably damaging Het
Racgap1 A T 15: 99,628,769 C304* probably null Het
Rbp3 T C 14: 33,956,909 V938A probably benign Het
Rpp30 A G 19: 36,094,427 K132E probably damaging Het
Rxfp2 A T 5: 150,043,099 R101* probably null Het
Ryr1 A T 7: 29,101,870 V823E probably damaging Het
S100pbp A T 4: 129,182,093 D146E probably damaging Het
Sdr9c7 T A 10: 127,902,258 V135E probably damaging Het
Serpinb12 A G 1: 106,946,614 D23G probably damaging Het
Serpinf1 T A 11: 75,413,981 T185S probably null Het
Slc23a1 A C 18: 35,625,851 C96G possibly damaging Het
Slc5a4a C T 10: 76,189,269 probably null Het
Suco A T 1: 161,834,054 L936Q probably damaging Het
Tmem144 T C 3: 79,825,299 Y224C probably damaging Het
Tpm4 T A 8: 72,144,754 probably null Het
Ttn T C 2: 76,730,070 E29329G probably damaging Het
Txn1 T C 4: 57,943,922 I101V probably benign Het
Ube2o A T 11: 116,544,607 C452S probably benign Het
Uhrf1bp1l T C 10: 89,782,586 V141A probably damaging Het
Uxs1 A T 1: 43,764,921 I278N probably damaging Het
Vps54 T C 11: 21,306,519 F663L probably damaging Het
Wdfy3 CG C 5: 101,926,525 probably null Het
Zc3h11a A G 1: 133,621,701 S741P probably damaging Het
Zdbf2 G A 1: 63,303,277 V272I possibly damaging Het
Zdhhc24 A G 19: 4,878,951 N68S probably damaging Het
Znfx1 A T 2: 167,044,066 L858* probably null Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 106022896 missense probably benign 0.00
IGL00691:Col6a4 APN 9 106057407 missense probably damaging 1.00
IGL01508:Col6a4 APN 9 106013605 missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 106068198 missense probably damaging 1.00
IGL01610:Col6a4 APN 9 106047707 splice site probably benign
IGL01813:Col6a4 APN 9 106077253 missense probably damaging 1.00
IGL01933:Col6a4 APN 9 106060114 missense probably benign 0.04
IGL01973:Col6a4 APN 9 106062894 missense probably damaging 1.00
IGL02053:Col6a4 APN 9 106063095 missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 106057418 missense probably benign 0.01
IGL02065:Col6a4 APN 9 106077103 missense probably damaging 0.99
IGL02106:Col6a4 APN 9 106063105 missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 106062942 missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 106068078 missense probably benign
IGL02234:Col6a4 APN 9 106013432 missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 106066732 missense probably benign 0.04
IGL02314:Col6a4 APN 9 105997156 missense probably damaging 0.99
IGL03065:Col6a4 APN 9 106041164 splice site probably benign
IGL03086:Col6a4 APN 9 106082862 splice site probably benign
IGL03185:Col6a4 APN 9 106019454 missense probably damaging 0.97
R0092:Col6a4 UTSW 9 106013314 missense probably benign 0.04
R0095:Col6a4 UTSW 9 106075356 missense probably benign 0.03
R0230:Col6a4 UTSW 9 106072366 missense probably benign 0.11
R0359:Col6a4 UTSW 9 105997146 missense probably benign
R0415:Col6a4 UTSW 9 106075080 missense probably damaging 0.99
R0433:Col6a4 UTSW 9 106067994 missense probably damaging 0.99
R0450:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0469:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0490:Col6a4 UTSW 9 106013770 missense probably damaging 0.99
R0621:Col6a4 UTSW 9 106066791 missense probably damaging 0.97
R0667:Col6a4 UTSW 9 106029959 splice site probably benign
R0681:Col6a4 UTSW 9 106067144 nonsense probably null
R0690:Col6a4 UTSW 9 106028187 splice site probably benign
R0714:Col6a4 UTSW 9 106017903 unclassified probably benign
R0788:Col6a4 UTSW 9 106071998 missense probably benign 0.15
R1036:Col6a4 UTSW 9 106068198 missense probably damaging 1.00
R1296:Col6a4 UTSW 9 106062853 missense possibly damaging 0.47
R1386:Col6a4 UTSW 9 106062945 missense probably benign 0.15
R1484:Col6a4 UTSW 9 106013302 critical splice donor site probably null
R1528:Col6a4 UTSW 9 106075220 missense probably damaging 0.99
R1555:Col6a4 UTSW 9 106000886 missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105997135 missense probably benign 0.01
R1653:Col6a4 UTSW 9 106072409 missense probably damaging 0.99
R1768:Col6a4 UTSW 9 106080100 missense probably benign
R1941:Col6a4 UTSW 9 106075010 missense probably benign 0.00
R2092:Col6a4 UTSW 9 106060331 missense probably damaging 1.00
R2134:Col6a4 UTSW 9 106066661 missense probably benign 0.09
R2149:Col6a4 UTSW 9 106076929 missense probably benign 0.00
R2174:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2204:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2248:Col6a4 UTSW 9 106079959 missense probably benign 0.15
R2568:Col6a4 UTSW 9 106063076 missense possibly damaging 0.90
R3750:Col6a4 UTSW 9 106020665 critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 106072114 missense probably damaging 0.98
R3776:Col6a4 UTSW 9 106051701 nonsense probably null
R3872:Col6a4 UTSW 9 106013659 missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 106072411 nonsense probably null
R4056:Col6a4 UTSW 9 106026466 missense probably damaging 0.98
R4212:Col6a4 UTSW 9 106075370 missense probably benign 0.28
R4417:Col6a4 UTSW 9 106072016 missense probably damaging 0.99
R4683:Col6a4 UTSW 9 106080130 missense probably benign 0.00
R4719:Col6a4 UTSW 9 106068252 missense probably damaging 0.99
R4791:Col6a4 UTSW 9 106080202 missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 106071979 missense probably benign 0.00
R4886:Col6a4 UTSW 9 106060072 missense probably benign 0.00
R4998:Col6a4 UTSW 9 105990778 utr 3 prime probably benign
R5091:Col6a4 UTSW 9 106075063 missense probably damaging 1.00
R5113:Col6a4 UTSW 9 106066960 missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 106013377 missense probably damaging 0.98
R5231:Col6a4 UTSW 9 106025531 missense probably damaging 0.96
R5297:Col6a4 UTSW 9 106074867 missense probably benign 0.02
R5352:Col6a4 UTSW 9 106061544 missense probably damaging 1.00
R5438:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 106072188 missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 106072198 missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105996116 missense probably benign 0.01
R5662:Col6a4 UTSW 9 106068001 missense probably damaging 0.99
R5777:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 106080275 missense probably damaging 0.99
R5929:Col6a4 UTSW 9 106063044 missense probably benign 0.15
R5999:Col6a4 UTSW 9 106067921 missense probably benign 0.11
R6243:Col6a4 UTSW 9 106013390 missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 106074986 missense probably damaging 0.96
R6288:Col6a4 UTSW 9 106068263 missense probably damaging 0.99
R6361:Col6a4 UTSW 9 106066703 missense probably benign 0.28
R6485:Col6a4 UTSW 9 106076870 critical splice donor site probably null
R6490:Col6a4 UTSW 9 106074992 nonsense probably null
R6537:Col6a4 UTSW 9 106067954 missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 106000412 missense probably damaging 0.99
R6643:Col6a4 UTSW 9 106000631 missense probably damaging 0.96
R6905:Col6a4 UTSW 9 106060318 splice site probably null
R6944:Col6a4 UTSW 9 106072171 missense probably damaging 0.98
R7015:Col6a4 UTSW 9 106033755 critical splice donor site probably null
R7027:Col6a4 UTSW 9 106067014 missense probably damaging 1.00
R7088:Col6a4 UTSW 9 106000686 missense possibly damaging 0.56
R7200:Col6a4 UTSW 9 106072249 missense possibly damaging 0.68
R7238:Col6a4 UTSW 9 106000320 missense probably damaging 0.99
R7273:Col6a4 UTSW 9 106000457 missense possibly damaging 0.92
R7335:Col6a4 UTSW 9 106076892 missense possibly damaging 0.90
R7418:Col6a4 UTSW 9 106022915 missense probably damaging 1.00
R7421:Col6a4 UTSW 9 106020795 missense probably damaging 0.99
R7530:Col6a4 UTSW 9 106068390 missense probably damaging 0.99
R7600:Col6a4 UTSW 9 106066999 missense possibly damaging 0.86
R7701:Col6a4 UTSW 9 106082888 missense probably benign 0.17
R7830:Col6a4 UTSW 9 106075390 missense probably damaging 0.99
R7881:Col6a4 UTSW 9 106080298 missense probably benign 0.14
R8157:Col6a4 UTSW 9 106067898 missense possibly damaging 0.92
R8292:Col6a4 UTSW 9 106076877 missense probably benign 0.01
R8309:Col6a4 UTSW 9 106075215 missense probably benign 0.08
R8336:Col6a4 UTSW 9 106075329 missense possibly damaging 0.65
R8359:Col6a4 UTSW 9 106068384 missense probably benign 0.00
R8530:Col6a4 UTSW 9 106080505 missense probably benign 0.31
R8556:Col6a4 UTSW 9 106067053 missense probably damaging 0.96
R8832:Col6a4 UTSW 9 106072154 missense probably benign
R9001:Col6a4 UTSW 9 106067171 missense probably benign 0.26
R9009:Col6a4 UTSW 9 106077205 missense probably benign 0.38
R9069:Col6a4 UTSW 9 106074939 missense possibly damaging 0.85
R9155:Col6a4 UTSW 9 106075010 missense probably benign
R9175:Col6a4 UTSW 9 106080361 missense probably benign
R9176:Col6a4 UTSW 9 106061556 missense probably damaging 1.00
R9295:Col6a4 UTSW 9 106080535 missense probably damaging 1.00
R9298:Col6a4 UTSW 9 106068335 missense probably damaging 0.96
R9389:Col6a4 UTSW 9 106000784 missense probably damaging 1.00
R9424:Col6a4 UTSW 9 106068072 missense probably benign 0.30
RF022:Col6a4 UTSW 9 106077008 missense probably damaging 0.99
X0025:Col6a4 UTSW 9 106000455 missense probably damaging 0.99
Z1176:Col6a4 UTSW 9 106000797 missense probably benign
Z1176:Col6a4 UTSW 9 106000870 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agagtaaccaagagtaacaaacatag -3'
(R):5'- cccagcatcacaagacaatac -3'
Posted On 2014-05-14