Incidental Mutation 'R1721:Kdm5b'
ID 191433
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine demethylase 5B
Synonyms 2010009J12Rik, PLU-1, Rb-Bp2, Jarid1b, D1Ertd202e, Plu1, 2210016I17Rik
MMRRC Submission 039753-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R1721 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 134487916-134560621 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 134540919 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
PDB Structure Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000047714
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112198
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,901,995 (GRCm39) V559E probably benign Het
Adamts20 A G 15: 94,236,340 (GRCm39) F844L probably benign Het
Adcy5 C A 16: 35,118,794 (GRCm39) D1048E probably damaging Het
Agrn A T 4: 156,259,630 (GRCm39) C768* probably null Het
Aldh18a1 G T 19: 40,553,282 (GRCm39) Q487K probably damaging Het
Aldh3b1 G A 19: 3,971,271 (GRCm39) probably benign Het
Asb18 T G 1: 89,896,302 (GRCm39) D246A probably benign Het
Atp2b1 T C 10: 98,832,750 (GRCm39) V417A probably damaging Het
Bcl2l15 A G 3: 103,745,914 (GRCm39) probably null Het
Brd10 A T 19: 29,720,998 (GRCm39) S743T probably damaging Het
Cage1 T A 13: 38,207,309 (GRCm39) K285* probably null Het
Ccn2 A C 10: 24,472,695 (GRCm39) T202P probably damaging Het
Cldn17 A G 16: 88,303,444 (GRCm39) L95P probably damaging Het
Cldn20 A T 17: 3,583,157 (GRCm39) D110V probably damaging Het
Cnot10 T C 9: 114,444,067 (GRCm39) T443A probably benign Het
Col14a1 T A 15: 55,310,858 (GRCm39) probably benign Het
Col23a1 T C 11: 51,418,716 (GRCm39) Y135H unknown Het
Cse1l T C 2: 166,768,331 (GRCm39) S210P probably damaging Het
Cspg4 T G 9: 56,796,027 (GRCm39) V1254G probably damaging Het
Dip2c A G 13: 9,709,404 (GRCm39) T1415A probably damaging Het
Epc2 A G 2: 49,422,117 (GRCm39) Y337C probably damaging Het
Epha2 A G 4: 141,049,963 (GRCm39) S799G probably damaging Het
Fndc10 A G 4: 155,779,355 (GRCm39) Y133C probably damaging Het
Gli3 G T 13: 15,900,882 (GRCm39) S1423I probably benign Het
Gm6034 A T 17: 36,354,045 (GRCm39) probably benign Het
Gmip A G 8: 70,263,882 (GRCm39) S109G probably damaging Het
Grik2 C A 10: 49,399,842 (GRCm39) W296L possibly damaging Het
Gucy2d T A 7: 98,103,268 (GRCm39) L504H probably damaging Het
Il6 T A 5: 30,218,490 (GRCm39) Y46N possibly damaging Het
Ints8 C A 4: 11,241,684 (GRCm39) C253F probably damaging Het
Itga9 A G 9: 118,527,374 (GRCm39) probably benign Het
Kcna7 T C 7: 45,056,345 (GRCm39) V187A possibly damaging Het
Knl1 T G 2: 118,906,815 (GRCm39) S1635A probably damaging Het
Lce1b A G 3: 92,563,318 (GRCm39) S72P unknown Het
Lox T G 18: 52,653,983 (GRCm39) probably null Het
Mdc1 A G 17: 36,158,718 (GRCm39) D366G possibly damaging Het
Meiob T C 17: 25,053,021 (GRCm39) C344R probably damaging Het
Mier2 A G 10: 79,384,664 (GRCm39) V150A probably damaging Het
Mon2 A T 10: 122,867,002 (GRCm39) M551K probably damaging Het
Mrps15 A G 4: 125,945,187 (GRCm39) T125A probably benign Het
Mtmr14 A G 6: 113,230,693 (GRCm39) H99R probably damaging Het
Mup4 A G 4: 59,960,598 (GRCm39) M1T probably null Het
Mup5 G A 4: 61,750,607 (GRCm39) R179* probably null Het
Ncoa3 T G 2: 165,911,221 (GRCm39) V1326G possibly damaging Het
Noa1 A T 5: 77,455,428 (GRCm39) N429K probably benign Het
Nrxn1 C T 17: 90,469,832 (GRCm39) A241T probably damaging Het
Or1p1 A T 11: 74,180,126 (GRCm39) Y218F probably damaging Het
Or2t49 C T 11: 58,392,765 (GRCm39) V206M probably damaging Het
Pcdh9 G A 14: 94,125,471 (GRCm39) S233L probably damaging Het
Peg3 C A 7: 6,712,900 (GRCm39) S774I possibly damaging Het
Phyh A G 2: 4,942,620 (GRCm39) K321R probably null Het
Plcg1 T A 2: 160,573,840 (GRCm39) M35K probably damaging Het
Pnisr C T 4: 21,874,086 (GRCm39) probably benign Het
Ppargc1b T A 18: 61,440,275 (GRCm39) probably null Het
Prcd A C 11: 116,548,371 (GRCm39) S27R probably benign Het
Prx T A 7: 27,216,948 (GRCm39) M622K probably benign Het
Psmd1 T A 1: 85,999,567 (GRCm39) D51E probably damaging Het
Psmd13 C T 7: 140,463,430 (GRCm39) T38I probably damaging Het
Ptprf A C 4: 118,082,096 (GRCm39) D1047E possibly damaging Het
Rai14 C A 15: 10,633,314 (GRCm39) Q25H probably damaging Het
Riiad1 G A 3: 94,380,176 (GRCm39) P40S possibly damaging Het
Rnft1 T A 11: 86,377,096 (GRCm39) N53K probably benign Het
Scn4a C T 11: 106,211,646 (GRCm39) R1457H probably benign Het
Sema6c A T 3: 95,078,099 (GRCm39) I492F probably damaging Het
Shbg T C 11: 69,505,798 (GRCm39) H403R probably damaging Het
Slc15a5 A T 6: 138,049,845 (GRCm39) probably benign Het
Slc38a1 G A 15: 96,485,016 (GRCm39) T221M probably damaging Het
Slc6a16 T A 7: 44,910,600 (GRCm39) V375E possibly damaging Het
Slc6a17 T A 3: 107,379,492 (GRCm39) M559L probably damaging Het
Slmap A G 14: 26,181,373 (GRCm39) probably benign Het
Sorcs2 G A 5: 36,184,092 (GRCm39) R965W probably damaging Het
St8sia4 C A 1: 95,581,394 (GRCm39) R116L probably damaging Het
Tcaf1 A C 6: 42,652,272 (GRCm39) S737A possibly damaging Het
Thbs2 T A 17: 14,899,072 (GRCm39) Y676F probably benign Het
Tmod2 A G 9: 75,493,324 (GRCm39) probably benign Het
Trim75 T C 8: 65,435,391 (GRCm39) probably null Het
Ubr5 A T 15: 38,042,090 (GRCm39) S169T probably benign Het
Usp54 A T 14: 20,633,508 (GRCm39) Y37* probably null Het
Vill T C 9: 118,895,082 (GRCm39) F100S probably damaging Het
Vstm5 A G 9: 15,168,663 (GRCm39) R76G probably benign Het
Zfp608 T C 18: 55,032,321 (GRCm39) T540A probably benign Het
Zfp947 A C 17: 22,365,184 (GRCm39) N163K probably benign Het
Zfyve26 T C 12: 79,308,573 (GRCm39) H228R possibly damaging Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134,548,693 (GRCm39) missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134,549,724 (GRCm39) missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134,530,278 (GRCm39) missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134,545,706 (GRCm39) missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134,528,465 (GRCm39) missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134,552,669 (GRCm39) missense probably benign 0.09
IGL02592:Kdm5b APN 1 134,552,591 (GRCm39) missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134,532,223 (GRCm39) missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134,516,511 (GRCm39) splice site probably benign
IGL03036:Kdm5b APN 1 134,536,675 (GRCm39) missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134,515,717 (GRCm39) missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134,555,055 (GRCm39) missense probably benign
IGL03342:Kdm5b APN 1 134,530,314 (GRCm39) missense probably benign 0.00
IGL03388:Kdm5b APN 1 134,555,060 (GRCm39) missense probably benign
amaryllis UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134,556,423 (GRCm39) missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134,532,372 (GRCm39) splice site probably benign
R0334:Kdm5b UTSW 1 134,532,260 (GRCm39) missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134,548,761 (GRCm39) critical splice donor site probably null
R0505:Kdm5b UTSW 1 134,530,309 (GRCm39) missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134,545,771 (GRCm39) missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134,516,642 (GRCm39) missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134,528,375 (GRCm39) missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134,541,729 (GRCm39) missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134,526,829 (GRCm39) missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134,540,992 (GRCm39) missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134,558,288 (GRCm39) missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134,552,635 (GRCm39) missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134,552,591 (GRCm39) missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134,530,219 (GRCm39) missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134,525,314 (GRCm39) splice site probably benign
R1741:Kdm5b UTSW 1 134,545,755 (GRCm39) missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134,532,205 (GRCm39) nonsense probably null
R1820:Kdm5b UTSW 1 134,525,408 (GRCm39) missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134,552,732 (GRCm39) missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134,541,611 (GRCm39) splice site probably null
R2056:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2059:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2405:Kdm5b UTSW 1 134,536,754 (GRCm39) missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134,515,715 (GRCm39) missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134,541,083 (GRCm39) missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134,558,280 (GRCm39) missense probably benign
R3803:Kdm5b UTSW 1 134,543,679 (GRCm39) missense probably benign 0.07
R3980:Kdm5b UTSW 1 134,547,408 (GRCm39) missense probably benign 0.11
R3983:Kdm5b UTSW 1 134,559,042 (GRCm39) missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134,555,067 (GRCm39) missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134,552,899 (GRCm39) missense probably benign 0.01
R4701:Kdm5b UTSW 1 134,533,750 (GRCm39) intron probably benign
R4791:Kdm5b UTSW 1 134,558,538 (GRCm39) missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134,521,053 (GRCm39) splice site probably null
R4924:Kdm5b UTSW 1 134,559,089 (GRCm39) missense probably benign 0.00
R5135:Kdm5b UTSW 1 134,516,484 (GRCm39) intron probably benign
R5248:Kdm5b UTSW 1 134,548,735 (GRCm39) missense probably benign 0.11
R5290:Kdm5b UTSW 1 134,549,837 (GRCm39) splice site probably null
R5358:Kdm5b UTSW 1 134,535,432 (GRCm39) nonsense probably null
R5388:Kdm5b UTSW 1 134,536,635 (GRCm39) nonsense probably null
R5396:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5397:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5398:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5399:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5529:Kdm5b UTSW 1 134,515,741 (GRCm39) missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134,558,979 (GRCm39) missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134,526,811 (GRCm39) missense probably benign 0.01
R5663:Kdm5b UTSW 1 134,558,373 (GRCm39) missense probably benign
R5822:Kdm5b UTSW 1 134,516,511 (GRCm39) splice site probably benign
R6226:Kdm5b UTSW 1 134,536,616 (GRCm39) missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134,526,945 (GRCm39) missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134,541,007 (GRCm39) missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
R7132:Kdm5b UTSW 1 134,526,844 (GRCm39) missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134,552,497 (GRCm39) missense probably benign
R7258:Kdm5b UTSW 1 134,548,759 (GRCm39) missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134,488,177 (GRCm39) missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134,532,235 (GRCm39) missense probably benign 0.14
R7426:Kdm5b UTSW 1 134,523,571 (GRCm39) missense probably benign 0.02
R7452:Kdm5b UTSW 1 134,552,686 (GRCm39) missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134,536,704 (GRCm39) missense probably benign 0.00
R7612:Kdm5b UTSW 1 134,552,656 (GRCm39) nonsense probably null
R7704:Kdm5b UTSW 1 134,515,669 (GRCm39) missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134,545,578 (GRCm39) missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134,547,411 (GRCm39) missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134,552,864 (GRCm39) missense probably benign 0.05
R8160:Kdm5b UTSW 1 134,541,657 (GRCm39) missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8930:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8932:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8950:Kdm5b UTSW 1 134,541,664 (GRCm39) missense possibly damaging 0.84
R9089:Kdm5b UTSW 1 134,535,506 (GRCm39) missense probably damaging 0.98
R9109:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9133:Kdm5b UTSW 1 134,530,323 (GRCm39) missense probably benign
R9298:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9423:Kdm5b UTSW 1 134,515,705 (GRCm39) missense possibly damaging 0.85
R9630:Kdm5b UTSW 1 134,512,971 (GRCm39) critical splice donor site probably null
R9670:Kdm5b UTSW 1 134,558,240 (GRCm39) nonsense probably null
X0063:Kdm5b UTSW 1 134,516,614 (GRCm39) missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134,552,773 (GRCm39) missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134,523,536 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATGCTAGGGATCAAATCCAGGGC -3'
(R):5'- TCACATGATGTAGGCAAACAAGTAGGC -3'

Sequencing Primer
(F):5'- agaagagggcatcacattacag -3'
(R):5'- TAGGCCAGGTTTACAAGAGC -3'
Posted On 2014-05-14