Incidental Mutation 'R1721:Ncoa3'
ID191439
Institutional Source Beutler Lab
Gene Symbol Ncoa3
Ensembl Gene ENSMUSG00000027678
Gene Namenuclear receptor coactivator 3
SynonymsTRAM-1, RAC3, AIB1, Src3, KAT13B, TRAM1, pCIP, bHLHe42, 2010305B15Rik
MMRRC Submission 039753-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R1721 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location165992636-166073242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 166069301 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 1326 (V1326G)
Ref Sequence ENSEMBL: ENSMUSP00000104875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088086] [ENSMUST00000088095] [ENSMUST00000109249] [ENSMUST00000109252] [ENSMUST00000146497]
Predicted Effect probably benign
Transcript: ENSMUST00000088086
SMART Domains Protein: ENSMUSP00000085405
Gene: ENSMUSG00000006800

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 669 5.6e-47 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000088095
AA Change: V1327G

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000085416
Gene: ENSMUSG00000027678
AA Change: V1327G

DomainStartEndE-ValueType
HLH 32 89 5.63e-9 SMART
PAS 113 179 1.16e-11 SMART
Pfam:PAS_11 261 372 1.6e-34 PFAM
Pfam:NCOA_u2 451 564 7.1e-46 PFAM
low complexity region 586 599 N/A INTRINSIC
Pfam:SRC-1 608 696 1.6e-32 PFAM
Pfam:DUF4927 714 801 2e-32 PFAM
coiled coil region 960 997 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1056 1104 2.1e-27 PFAM
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1221 1233 N/A INTRINSIC
low complexity region 1243 1263 N/A INTRINSIC
DUF1518 1270 1327 1.08e-21 SMART
low complexity region 1384 1398 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109249
SMART Domains Protein: ENSMUSP00000104872
Gene: ENSMUSG00000006800

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 532 670 1.3e-46 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109252
AA Change: V1326G

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104875
Gene: ENSMUSG00000027678
AA Change: V1326G

DomainStartEndE-ValueType
HLH 32 89 5.63e-9 SMART
PAS 113 179 1.16e-11 SMART
Pfam:PAS_11 261 372 4.1e-34 PFAM
low complexity region 438 467 N/A INTRINSIC
low complexity region 502 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Pfam:SRC-1 608 696 3.5e-28 PFAM
coiled coil region 960 997 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1056 1106 6.6e-29 PFAM
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1218 1232 N/A INTRINSIC
low complexity region 1242 1262 N/A INTRINSIC
DUF1518 1269 1326 1.08e-21 SMART
low complexity region 1383 1397 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139658
Predicted Effect probably benign
Transcript: ENSMUST00000146497
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear receptor coactivator that interacts with nuclear hormone receptors to enhance their transcriptional activator functions. The encoded protein has histone acetyltransferase activity and recruits p300/CBP-associated factor and CREB binding protein as part of a multisubunit coactivation complex. This protein is initially found in the cytoplasm but is translocated into the nucleus upon phosphorylation. Several transcript variants encoding different isoforms have been found for this gene. In addition, a polymorphic repeat region is found in the C-terminus of the encoded protein. [provided by RefSeq, Mar 2010]
PHENOTYPE: Nullizygous mice exhibit growth defects and reduced serum IGF-1 levels and may show impaired proliferative responses to various factors, delayed mammary gland growth and puberty, reproductive dysfunction, susceptibility to endotoxin shock, altered lymphopoiesis, and protection against obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,743,598 S743T probably damaging Het
Acin1 A T 14: 54,664,538 V559E probably benign Het
Adamts20 A G 15: 94,338,459 F844L probably benign Het
Adcy5 C A 16: 35,298,424 D1048E probably damaging Het
Agrn A T 4: 156,175,173 C768* probably null Het
Aldh18a1 G T 19: 40,564,838 Q487K probably damaging Het
Aldh3b1 G A 19: 3,921,271 probably benign Het
Asb18 T G 1: 89,968,580 D246A probably benign Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
Bcl2l15 A G 3: 103,838,598 probably null Het
Cage1 T A 13: 38,023,333 K285* probably null Het
Cldn17 A G 16: 88,506,556 L95P probably damaging Het
Cldn20 A T 17: 3,532,882 D110V probably damaging Het
Cnot10 T C 9: 114,614,999 T443A probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Col23a1 T C 11: 51,527,889 Y135H unknown Het
Cse1l T C 2: 166,926,411 S210P probably damaging Het
Cspg4 T G 9: 56,888,743 V1254G probably damaging Het
Ctgf A C 10: 24,596,797 T202P probably damaging Het
Dip2c A G 13: 9,659,368 T1415A probably damaging Het
Epc2 A G 2: 49,532,105 Y337C probably damaging Het
Epha2 A G 4: 141,322,652 S799G probably damaging Het
Fndc10 A G 4: 155,694,898 Y133C probably damaging Het
Gli3 G T 13: 15,726,297 S1423I probably benign Het
Gm6034 A T 17: 36,043,153 probably benign Het
Gmip A G 8: 69,811,232 S109G probably damaging Het
Grik2 C A 10: 49,523,746 W296L possibly damaging Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Il6 T A 5: 30,013,492 Y46N possibly damaging Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Itga9 A G 9: 118,698,306 probably benign Het
Kcna7 T C 7: 45,406,921 V187A possibly damaging Het
Kdm5b G T 1: 134,613,181 probably benign Het
Knl1 T G 2: 119,076,334 S1635A probably damaging Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lox T G 18: 52,520,911 probably null Het
Mdc1 A G 17: 35,847,826 D366G possibly damaging Het
Meiob T C 17: 24,834,047 C344R probably damaging Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Mon2 A T 10: 123,031,097 M551K probably damaging Het
Mrps15 A G 4: 126,051,394 T125A probably benign Het
Mtmr14 A G 6: 113,253,732 H99R probably damaging Het
Mup4 A G 4: 59,960,598 M1T probably null Het
Mup5 G A 4: 61,832,370 R179* probably null Het
Noa1 A T 5: 77,307,581 N429K probably benign Het
Nrxn1 C T 17: 90,162,404 A241T probably damaging Het
Olfr331 C T 11: 58,501,939 V206M probably damaging Het
Olfr59 A T 11: 74,289,300 Y218F probably damaging Het
Pcdh9 G A 14: 93,888,035 S233L probably damaging Het
Peg3 C A 7: 6,709,901 S774I possibly damaging Het
Phyh A G 2: 4,937,809 K321R probably null Het
Plcg1 T A 2: 160,731,920 M35K probably damaging Het
Pnisr C T 4: 21,874,086 probably benign Het
Ppargc1b T A 18: 61,307,204 probably null Het
Prcd A C 11: 116,657,545 S27R probably benign Het
Prx T A 7: 27,517,523 M622K probably benign Het
Psmd1 T A 1: 86,071,845 D51E probably damaging Het
Psmd13 C T 7: 140,883,517 T38I probably damaging Het
Ptprf A C 4: 118,224,899 D1047E possibly damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Riiad1 G A 3: 94,472,869 P40S possibly damaging Het
Rnft1 T A 11: 86,486,270 N53K probably benign Het
Scn4a C T 11: 106,320,820 R1457H probably benign Het
Sema6c A T 3: 95,170,788 I492F probably damaging Het
Shbg T C 11: 69,614,972 H403R probably damaging Het
Slc15a5 A T 6: 138,072,847 probably benign Het
Slc38a1 G A 15: 96,587,135 T221M probably damaging Het
Slc6a16 T A 7: 45,261,176 V375E possibly damaging Het
Slc6a17 T A 3: 107,472,176 M559L probably damaging Het
Slmap A G 14: 26,460,218 probably benign Het
Sorcs2 G A 5: 36,026,748 R965W probably damaging Het
St8sia4 C A 1: 95,653,669 R116L probably damaging Het
Tcaf1 A C 6: 42,675,338 S737A possibly damaging Het
Thbs2 T A 17: 14,678,810 Y676F probably benign Het
Tmod2 A G 9: 75,586,042 probably benign Het
Trim75 T C 8: 64,982,739 probably null Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp54 A T 14: 20,583,440 Y37* probably null Het
Vill T C 9: 119,066,014 F100S probably damaging Het
Vstm5 A G 9: 15,257,367 R76G probably benign Het
Zfp608 T C 18: 54,899,249 T540A probably benign Het
Zfp947 A C 17: 22,146,203 N163K probably benign Het
Zfyve26 T C 12: 79,261,799 H228R possibly damaging Het
Other mutations in Ncoa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Ncoa3 APN 2 166051609 splice site probably null
IGL01068:Ncoa3 APN 2 166052795 missense probably damaging 1.00
IGL01300:Ncoa3 APN 2 166068461 missense probably benign 0.41
IGL01336:Ncoa3 APN 2 166054523 missense probably benign
IGL01533:Ncoa3 APN 2 166055025 missense probably benign 0.03
IGL01658:Ncoa3 APN 2 166051302 splice site probably benign
IGL02053:Ncoa3 APN 2 166054834 missense probably damaging 1.00
IGL02138:Ncoa3 APN 2 166055262 missense probably benign
IGL02167:Ncoa3 APN 2 166070136 missense probably damaging 1.00
IGL02217:Ncoa3 APN 2 166055346 missense probably damaging 1.00
IGL02312:Ncoa3 APN 2 166057200 missense probably benign 0.10
IGL02381:Ncoa3 APN 2 166052817 missense probably damaging 1.00
IGL02568:Ncoa3 APN 2 166069357 missense probably damaging 1.00
IGL02658:Ncoa3 APN 2 166051393 missense probably benign 0.01
IGL02806:Ncoa3 APN 2 166052432 missense probably benign 0.25
R0054:Ncoa3 UTSW 2 166055178 missense possibly damaging 0.67
R0054:Ncoa3 UTSW 2 166055178 missense possibly damaging 0.67
R0240:Ncoa3 UTSW 2 166054400 missense probably benign
R0240:Ncoa3 UTSW 2 166054400 missense probably benign
R0333:Ncoa3 UTSW 2 166054291 missense probably damaging 1.00
R0379:Ncoa3 UTSW 2 166054502 missense probably damaging 0.97
R0411:Ncoa3 UTSW 2 166068543 missense probably benign 0.31
R0734:Ncoa3 UTSW 2 166069191 unclassified probably benign
R1434:Ncoa3 UTSW 2 166055510 missense probably benign 0.01
R1491:Ncoa3 UTSW 2 166055262 missense probably benign
R1895:Ncoa3 UTSW 2 166059177 missense possibly damaging 0.68
R1896:Ncoa3 UTSW 2 166048464 missense probably benign 0.36
R1946:Ncoa3 UTSW 2 166059177 missense possibly damaging 0.68
R2406:Ncoa3 UTSW 2 166055359 missense probably damaging 1.00
R3800:Ncoa3 UTSW 2 166059719 missense possibly damaging 0.58
R3825:Ncoa3 UTSW 2 166054798 missense possibly damaging 0.83
R4377:Ncoa3 UTSW 2 166054497 missense possibly damaging 0.50
R4674:Ncoa3 UTSW 2 166059811 missense probably benign
R4706:Ncoa3 UTSW 2 166047879 missense probably damaging 1.00
R4751:Ncoa3 UTSW 2 166069903 missense possibly damaging 0.81
R4954:Ncoa3 UTSW 2 166065786 missense probably benign
R4976:Ncoa3 UTSW 2 166047900 missense probably damaging 1.00
R4992:Ncoa3 UTSW 2 166069939 missense probably benign 0.39
R5100:Ncoa3 UTSW 2 166050097 missense probably damaging 1.00
R5578:Ncoa3 UTSW 2 166054328 missense probably benign 0.00
R5932:Ncoa3 UTSW 2 166070125 splice site probably null
R6051:Ncoa3 UTSW 2 166058765 missense probably damaging 1.00
R6370:Ncoa3 UTSW 2 166065905 missense probably benign 0.00
R6372:Ncoa3 UTSW 2 166059347 missense possibly damaging 0.94
R6373:Ncoa3 UTSW 2 166059347 missense possibly damaging 0.94
R7438:Ncoa3 UTSW 2 166068529 missense probably damaging 1.00
R7660:Ncoa3 UTSW 2 166069321 missense probably benign 0.00
X0018:Ncoa3 UTSW 2 166054802 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AGATGTGTTGTTAGAGAGTGCAGCC -3'
(R):5'- TGCCTCAGTTTCTAAGAGCCAAGC -3'

Sequencing Primer
(F):5'- GACTTTGTCATCTTAGTGAGAAGC -3'
(R):5'- TTCTAAGAGCCAAGCACATGATCTC -3'
Posted On2014-05-14