Incidental Mutation 'R1721:Slc6a17'
ID 191444
Institutional Source Beutler Lab
Gene Symbol Slc6a17
Ensembl Gene ENSMUSG00000027894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 17
Synonyms NTT4, D130012J15Rik
MMRRC Submission 039753-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R1721 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 107374864-107425334 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107379492 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 559 (M559L)
Ref Sequence ENSEMBL: ENSMUSP00000129379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029499] [ENSMUST00000168211] [ENSMUST00000169449]
AlphaFold Q8BJI1
Predicted Effect probably damaging
Transcript: ENSMUST00000029499
AA Change: M556L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029499
Gene: ENSMUSG00000027894
AA Change: M556L

DomainStartEndE-ValueType
Pfam:SNF 60 640 2.7e-227 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168211
AA Change: M518L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131888
Gene: ENSMUSG00000027894
AA Change: M518L

DomainStartEndE-ValueType
Pfam:SNF 19 602 1.3e-225 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169449
AA Change: M559L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129379
Gene: ENSMUSG00000027894
AA Change: M559L

DomainStartEndE-ValueType
Pfam:SNF 60 643 1.1e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171029
Meta Mutation Damage Score 0.3921 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. Defects in this gene are a cause of autosomal recessive mental retardation-48. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,901,995 (GRCm39) V559E probably benign Het
Adamts20 A G 15: 94,236,340 (GRCm39) F844L probably benign Het
Adcy5 C A 16: 35,118,794 (GRCm39) D1048E probably damaging Het
Agrn A T 4: 156,259,630 (GRCm39) C768* probably null Het
Aldh18a1 G T 19: 40,553,282 (GRCm39) Q487K probably damaging Het
Aldh3b1 G A 19: 3,971,271 (GRCm39) probably benign Het
Asb18 T G 1: 89,896,302 (GRCm39) D246A probably benign Het
Atp2b1 T C 10: 98,832,750 (GRCm39) V417A probably damaging Het
Bcl2l15 A G 3: 103,745,914 (GRCm39) probably null Het
Brd10 A T 19: 29,720,998 (GRCm39) S743T probably damaging Het
Cage1 T A 13: 38,207,309 (GRCm39) K285* probably null Het
Ccn2 A C 10: 24,472,695 (GRCm39) T202P probably damaging Het
Cldn17 A G 16: 88,303,444 (GRCm39) L95P probably damaging Het
Cldn20 A T 17: 3,583,157 (GRCm39) D110V probably damaging Het
Cnot10 T C 9: 114,444,067 (GRCm39) T443A probably benign Het
Col14a1 T A 15: 55,310,858 (GRCm39) probably benign Het
Col23a1 T C 11: 51,418,716 (GRCm39) Y135H unknown Het
Cse1l T C 2: 166,768,331 (GRCm39) S210P probably damaging Het
Cspg4 T G 9: 56,796,027 (GRCm39) V1254G probably damaging Het
Dip2c A G 13: 9,709,404 (GRCm39) T1415A probably damaging Het
Epc2 A G 2: 49,422,117 (GRCm39) Y337C probably damaging Het
Epha2 A G 4: 141,049,963 (GRCm39) S799G probably damaging Het
Fndc10 A G 4: 155,779,355 (GRCm39) Y133C probably damaging Het
Gli3 G T 13: 15,900,882 (GRCm39) S1423I probably benign Het
Gm6034 A T 17: 36,354,045 (GRCm39) probably benign Het
Gmip A G 8: 70,263,882 (GRCm39) S109G probably damaging Het
Grik2 C A 10: 49,399,842 (GRCm39) W296L possibly damaging Het
Gucy2d T A 7: 98,103,268 (GRCm39) L504H probably damaging Het
Il6 T A 5: 30,218,490 (GRCm39) Y46N possibly damaging Het
Ints8 C A 4: 11,241,684 (GRCm39) C253F probably damaging Het
Itga9 A G 9: 118,527,374 (GRCm39) probably benign Het
Kcna7 T C 7: 45,056,345 (GRCm39) V187A possibly damaging Het
Kdm5b G T 1: 134,540,919 (GRCm39) probably benign Het
Knl1 T G 2: 118,906,815 (GRCm39) S1635A probably damaging Het
Lce1b A G 3: 92,563,318 (GRCm39) S72P unknown Het
Lox T G 18: 52,653,983 (GRCm39) probably null Het
Mdc1 A G 17: 36,158,718 (GRCm39) D366G possibly damaging Het
Meiob T C 17: 25,053,021 (GRCm39) C344R probably damaging Het
Mier2 A G 10: 79,384,664 (GRCm39) V150A probably damaging Het
Mon2 A T 10: 122,867,002 (GRCm39) M551K probably damaging Het
Mrps15 A G 4: 125,945,187 (GRCm39) T125A probably benign Het
Mtmr14 A G 6: 113,230,693 (GRCm39) H99R probably damaging Het
Mup4 A G 4: 59,960,598 (GRCm39) M1T probably null Het
Mup5 G A 4: 61,750,607 (GRCm39) R179* probably null Het
Ncoa3 T G 2: 165,911,221 (GRCm39) V1326G possibly damaging Het
Noa1 A T 5: 77,455,428 (GRCm39) N429K probably benign Het
Nrxn1 C T 17: 90,469,832 (GRCm39) A241T probably damaging Het
Or1p1 A T 11: 74,180,126 (GRCm39) Y218F probably damaging Het
Or2t49 C T 11: 58,392,765 (GRCm39) V206M probably damaging Het
Pcdh9 G A 14: 94,125,471 (GRCm39) S233L probably damaging Het
Peg3 C A 7: 6,712,900 (GRCm39) S774I possibly damaging Het
Phyh A G 2: 4,942,620 (GRCm39) K321R probably null Het
Plcg1 T A 2: 160,573,840 (GRCm39) M35K probably damaging Het
Pnisr C T 4: 21,874,086 (GRCm39) probably benign Het
Ppargc1b T A 18: 61,440,275 (GRCm39) probably null Het
Prcd A C 11: 116,548,371 (GRCm39) S27R probably benign Het
Prx T A 7: 27,216,948 (GRCm39) M622K probably benign Het
Psmd1 T A 1: 85,999,567 (GRCm39) D51E probably damaging Het
Psmd13 C T 7: 140,463,430 (GRCm39) T38I probably damaging Het
Ptprf A C 4: 118,082,096 (GRCm39) D1047E possibly damaging Het
Rai14 C A 15: 10,633,314 (GRCm39) Q25H probably damaging Het
Riiad1 G A 3: 94,380,176 (GRCm39) P40S possibly damaging Het
Rnft1 T A 11: 86,377,096 (GRCm39) N53K probably benign Het
Scn4a C T 11: 106,211,646 (GRCm39) R1457H probably benign Het
Sema6c A T 3: 95,078,099 (GRCm39) I492F probably damaging Het
Shbg T C 11: 69,505,798 (GRCm39) H403R probably damaging Het
Slc15a5 A T 6: 138,049,845 (GRCm39) probably benign Het
Slc38a1 G A 15: 96,485,016 (GRCm39) T221M probably damaging Het
Slc6a16 T A 7: 44,910,600 (GRCm39) V375E possibly damaging Het
Slmap A G 14: 26,181,373 (GRCm39) probably benign Het
Sorcs2 G A 5: 36,184,092 (GRCm39) R965W probably damaging Het
St8sia4 C A 1: 95,581,394 (GRCm39) R116L probably damaging Het
Tcaf1 A C 6: 42,652,272 (GRCm39) S737A possibly damaging Het
Thbs2 T A 17: 14,899,072 (GRCm39) Y676F probably benign Het
Tmod2 A G 9: 75,493,324 (GRCm39) probably benign Het
Trim75 T C 8: 65,435,391 (GRCm39) probably null Het
Ubr5 A T 15: 38,042,090 (GRCm39) S169T probably benign Het
Usp54 A T 14: 20,633,508 (GRCm39) Y37* probably null Het
Vill T C 9: 118,895,082 (GRCm39) F100S probably damaging Het
Vstm5 A G 9: 15,168,663 (GRCm39) R76G probably benign Het
Zfp608 T C 18: 55,032,321 (GRCm39) T540A probably benign Het
Zfp947 A C 17: 22,365,184 (GRCm39) N163K probably benign Het
Zfyve26 T C 12: 79,308,573 (GRCm39) H228R possibly damaging Het
Other mutations in Slc6a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Slc6a17 APN 3 107,400,493 (GRCm39) missense possibly damaging 0.56
IGL02514:Slc6a17 APN 3 107,402,993 (GRCm39) missense possibly damaging 0.94
IGL03395:Slc6a17 APN 3 107,384,622 (GRCm39) missense probably damaging 1.00
BB002:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
BB012:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R0454:Slc6a17 UTSW 3 107,384,183 (GRCm39) missense probably benign 0.12
R1201:Slc6a17 UTSW 3 107,400,388 (GRCm39) missense possibly damaging 0.90
R1551:Slc6a17 UTSW 3 107,379,443 (GRCm39) missense possibly damaging 0.85
R1681:Slc6a17 UTSW 3 107,381,702 (GRCm39) missense probably damaging 1.00
R1765:Slc6a17 UTSW 3 107,380,895 (GRCm39) missense possibly damaging 0.95
R1867:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R2167:Slc6a17 UTSW 3 107,398,817 (GRCm39) nonsense probably null
R3708:Slc6a17 UTSW 3 107,400,401 (GRCm39) missense probably benign
R3814:Slc6a17 UTSW 3 107,378,633 (GRCm39) missense possibly damaging 0.92
R4639:Slc6a17 UTSW 3 107,381,597 (GRCm39) missense probably benign
R4807:Slc6a17 UTSW 3 107,407,803 (GRCm39) missense possibly damaging 0.90
R5048:Slc6a17 UTSW 3 107,378,753 (GRCm39) nonsense probably null
R6076:Slc6a17 UTSW 3 107,379,387 (GRCm39) missense possibly damaging 0.67
R6326:Slc6a17 UTSW 3 107,407,722 (GRCm39) missense probably damaging 0.98
R6713:Slc6a17 UTSW 3 107,378,703 (GRCm39) missense probably benign 0.00
R7073:Slc6a17 UTSW 3 107,378,755 (GRCm39) missense probably benign 0.00
R7097:Slc6a17 UTSW 3 107,400,464 (GRCm39) missense probably damaging 1.00
R7323:Slc6a17 UTSW 3 107,398,794 (GRCm39) missense probably benign 0.01
R7597:Slc6a17 UTSW 3 107,378,668 (GRCm39) missense possibly damaging 0.89
R7755:Slc6a17 UTSW 3 107,381,671 (GRCm39) missense probably damaging 1.00
R7841:Slc6a17 UTSW 3 107,384,214 (GRCm39) missense possibly damaging 0.69
R7925:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R8041:Slc6a17 UTSW 3 107,381,744 (GRCm39) missense probably damaging 1.00
R8305:Slc6a17 UTSW 3 107,380,901 (GRCm39) missense probably benign 0.31
R8306:Slc6a17 UTSW 3 107,380,985 (GRCm39) missense probably benign
R8488:Slc6a17 UTSW 3 107,384,574 (GRCm39) missense possibly damaging 0.84
R8930:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R8932:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R9287:Slc6a17 UTSW 3 107,384,551 (GRCm39) missense probably damaging 1.00
R9483:Slc6a17 UTSW 3 107,378,772 (GRCm39) missense possibly damaging 0.50
R9601:Slc6a17 UTSW 3 107,380,930 (GRCm39) missense possibly damaging 0.95
R9617:Slc6a17 UTSW 3 107,384,685 (GRCm39) missense probably damaging 1.00
X0010:Slc6a17 UTSW 3 107,400,422 (GRCm39) missense probably benign 0.05
X0062:Slc6a17 UTSW 3 107,407,684 (GRCm39) missense probably null 1.00
Z1176:Slc6a17 UTSW 3 107,384,082 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAACAAGACCTGTTACAGAGGAGC -3'
(R):5'- CTGGAGATCACAGAACACTGAAGGC -3'

Sequencing Primer
(F):5'- CCTGAGAAGATGCCAGAGACTC -3'
(R):5'- CAGAACACTGAAGGCAAAGGC -3'
Posted On 2014-05-14