Incidental Mutation 'R1721:Noa1'
ID191457
Institutional Source Beutler Lab
Gene Symbol Noa1
Ensembl Gene ENSMUSG00000036285
Gene Namenitric oxide associated 1
Synonyms2610024G14Rik, mAtNOS1
MMRRC Submission 039753-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1721 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location77294182-77310084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77307581 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 429 (N429K)
Ref Sequence ENSEMBL: ENSMUSP00000045948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031167] [ENSMUST00000047860]
Predicted Effect probably benign
Transcript: ENSMUST00000031167
SMART Domains Protein: ENSMUSP00000031167
Gene: ENSMUSG00000029250

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:RNA_pol_Rpb2_1 38 442 2.5e-69 PFAM
Pfam:RNA_pol_Rpb2_2 201 394 3.7e-57 PFAM
Pfam:RNA_pol_Rpb2_3 468 532 6.1e-25 PFAM
Pfam:RNA_pol_Rpb2_4 567 629 7.4e-27 PFAM
Pfam:RNA_pol_Rpb2_5 653 700 1.6e-22 PFAM
Pfam:RNA_pol_Rpb2_6 707 1080 4.5e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1082 1174 3.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047860
AA Change: N429K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000045948
Gene: ENSMUSG00000036285
AA Change: N429K

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
coiled coil region 83 125 N/A INTRINSIC
low complexity region 224 238 N/A INTRINSIC
Pfam:MMR_HSR1 342 526 6.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150722
Meta Mutation Damage Score 0.1093 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear-encoded GTPase that functions in the mitochondrion. Upon translation, this protein is imported into the nucleus and then into the nucleolus before being exported to the mitochondrion. The encoded protein is required for oxygen-dependent regulation of mitochondrial respiratory complexes and for mitochondrial protein synthesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis associated with developmental retardation, decreased cell proliferation and apoptosis, increased cell necrosis, and abnormal mitochondrial morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,743,598 S743T probably damaging Het
Acin1 A T 14: 54,664,538 V559E probably benign Het
Adamts20 A G 15: 94,338,459 F844L probably benign Het
Adcy5 C A 16: 35,298,424 D1048E probably damaging Het
Agrn A T 4: 156,175,173 C768* probably null Het
Aldh18a1 G T 19: 40,564,838 Q487K probably damaging Het
Aldh3b1 G A 19: 3,921,271 probably benign Het
Asb18 T G 1: 89,968,580 D246A probably benign Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
Bcl2l15 A G 3: 103,838,598 probably null Het
Cage1 T A 13: 38,023,333 K285* probably null Het
Cldn17 A G 16: 88,506,556 L95P probably damaging Het
Cldn20 A T 17: 3,532,882 D110V probably damaging Het
Cnot10 T C 9: 114,614,999 T443A probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Col23a1 T C 11: 51,527,889 Y135H unknown Het
Cse1l T C 2: 166,926,411 S210P probably damaging Het
Cspg4 T G 9: 56,888,743 V1254G probably damaging Het
Ctgf A C 10: 24,596,797 T202P probably damaging Het
Dip2c A G 13: 9,659,368 T1415A probably damaging Het
Epc2 A G 2: 49,532,105 Y337C probably damaging Het
Epha2 A G 4: 141,322,652 S799G probably damaging Het
Fndc10 A G 4: 155,694,898 Y133C probably damaging Het
Gli3 G T 13: 15,726,297 S1423I probably benign Het
Gm6034 A T 17: 36,043,153 probably benign Het
Gmip A G 8: 69,811,232 S109G probably damaging Het
Grik2 C A 10: 49,523,746 W296L possibly damaging Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Il6 T A 5: 30,013,492 Y46N possibly damaging Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Itga9 A G 9: 118,698,306 probably benign Het
Kcna7 T C 7: 45,406,921 V187A possibly damaging Het
Kdm5b G T 1: 134,613,181 probably benign Het
Knl1 T G 2: 119,076,334 S1635A probably damaging Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lox T G 18: 52,520,911 probably null Het
Mdc1 A G 17: 35,847,826 D366G possibly damaging Het
Meiob T C 17: 24,834,047 C344R probably damaging Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Mon2 A T 10: 123,031,097 M551K probably damaging Het
Mrps15 A G 4: 126,051,394 T125A probably benign Het
Mtmr14 A G 6: 113,253,732 H99R probably damaging Het
Mup4 A G 4: 59,960,598 M1T probably null Het
Mup5 G A 4: 61,832,370 R179* probably null Het
Ncoa3 T G 2: 166,069,301 V1326G possibly damaging Het
Nrxn1 C T 17: 90,162,404 A241T probably damaging Het
Olfr331 C T 11: 58,501,939 V206M probably damaging Het
Olfr59 A T 11: 74,289,300 Y218F probably damaging Het
Pcdh9 G A 14: 93,888,035 S233L probably damaging Het
Peg3 C A 7: 6,709,901 S774I possibly damaging Het
Phyh A G 2: 4,937,809 K321R probably null Het
Plcg1 T A 2: 160,731,920 M35K probably damaging Het
Pnisr C T 4: 21,874,086 probably benign Het
Ppargc1b T A 18: 61,307,204 probably null Het
Prcd A C 11: 116,657,545 S27R probably benign Het
Prx T A 7: 27,517,523 M622K probably benign Het
Psmd1 T A 1: 86,071,845 D51E probably damaging Het
Psmd13 C T 7: 140,883,517 T38I probably damaging Het
Ptprf A C 4: 118,224,899 D1047E possibly damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Riiad1 G A 3: 94,472,869 P40S possibly damaging Het
Rnft1 T A 11: 86,486,270 N53K probably benign Het
Scn4a C T 11: 106,320,820 R1457H probably benign Het
Sema6c A T 3: 95,170,788 I492F probably damaging Het
Shbg T C 11: 69,614,972 H403R probably damaging Het
Slc15a5 A T 6: 138,072,847 probably benign Het
Slc38a1 G A 15: 96,587,135 T221M probably damaging Het
Slc6a16 T A 7: 45,261,176 V375E possibly damaging Het
Slc6a17 T A 3: 107,472,176 M559L probably damaging Het
Slmap A G 14: 26,460,218 probably benign Het
Sorcs2 G A 5: 36,026,748 R965W probably damaging Het
St8sia4 C A 1: 95,653,669 R116L probably damaging Het
Tcaf1 A C 6: 42,675,338 S737A possibly damaging Het
Thbs2 T A 17: 14,678,810 Y676F probably benign Het
Tmod2 A G 9: 75,586,042 probably benign Het
Trim75 T C 8: 64,982,739 probably null Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp54 A T 14: 20,583,440 Y37* probably null Het
Vill T C 9: 119,066,014 F100S probably damaging Het
Vstm5 A G 9: 15,257,367 R76G probably benign Het
Zfp608 T C 18: 54,899,249 T540A probably benign Het
Zfp947 A C 17: 22,146,203 N163K probably benign Het
Zfyve26 T C 12: 79,261,799 H228R possibly damaging Het
Other mutations in Noa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Noa1 APN 5 77307579 missense probably benign
IGL02850:Noa1 APN 5 77294491 missense probably benign 0.14
R0149:Noa1 UTSW 5 77297173 nonsense probably null
R0361:Noa1 UTSW 5 77297173 nonsense probably null
R0645:Noa1 UTSW 5 77309875 missense probably benign 0.00
R1226:Noa1 UTSW 5 77307555 missense possibly damaging 0.82
R1710:Noa1 UTSW 5 77309725 missense possibly damaging 0.49
R1732:Noa1 UTSW 5 77306374 missense probably benign 0.01
R2061:Noa1 UTSW 5 77304187 missense possibly damaging 0.64
R2262:Noa1 UTSW 5 77309804 nonsense probably null
R2965:Noa1 UTSW 5 77306344 missense possibly damaging 0.79
R2966:Noa1 UTSW 5 77306344 missense possibly damaging 0.79
R4405:Noa1 UTSW 5 77306372 missense probably benign 0.00
R4664:Noa1 UTSW 5 77299753 missense probably benign 0.31
R4849:Noa1 UTSW 5 77306332 missense possibly damaging 0.61
R4920:Noa1 UTSW 5 77306487 splice site probably null
R5005:Noa1 UTSW 5 77309026 missense probably damaging 1.00
R5325:Noa1 UTSW 5 77304195 missense probably damaging 1.00
R6112:Noa1 UTSW 5 77309746 missense probably benign 0.01
R6254:Noa1 UTSW 5 77309669 missense probably benign 0.12
R7659:Noa1 UTSW 5 77309390 missense not run
Predicted Primers PCR Primer
(F):5'- AGACCTTTACTGCCGTTGCTAGTTTG -3'
(R):5'- AGCTGTCTATGTACCTTGGGTGTACTAC -3'

Sequencing Primer
(F):5'- GGGTTTCCAAACAATAGTAACCTTTC -3'
(R):5'- agcattagaaaagttgagcacc -3'
Posted On2014-05-14