Incidental Mutation 'R1721:Cspg4'
ID191470
Institutional Source Beutler Lab
Gene Symbol Cspg4
Ensembl Gene ENSMUSG00000032911
Gene Namechondroitin sulfate proteoglycan 4
SynonymsAN2, 4732461B14Rik, NG2
MMRRC Submission 039753-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1721 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56865033-56899870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 56888743 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 1254 (V1254G)
Ref Sequence ENSEMBL: ENSMUSP00000038909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035661]
Predicted Effect probably damaging
Transcript: ENSMUST00000035661
AA Change: V1254G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: V1254G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
LamG 47 179 9.16e-22 SMART
LamG 223 364 3.52e-23 SMART
low complexity region 384 397 N/A INTRINSIC
Pfam:Cadherin_3 495 646 1e-36 PFAM
Pfam:Cadherin_3 732 885 7.9e-14 PFAM
Pfam:Cadherin_3 868 996 7e-15 PFAM
Pfam:Cadherin_3 972 1115 9e-26 PFAM
Pfam:Cadherin_3 1116 1223 1.1e-10 PFAM
Pfam:Cadherin_3 1225 1344 3.3e-12 PFAM
Pfam:Cadherin_3 1425 1568 6.3e-52 PFAM
Pfam:Cadherin_3 1578 1684 9.7e-9 PFAM
Pfam:Cadherin_3 1674 1809 3.2e-9 PFAM
Pfam:Cadherin_3 1779 1929 1.6e-31 PFAM
transmembrane domain 2229 2251 N/A INTRINSIC
low complexity region 2295 2305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215666
Meta Mutation Damage Score 0.7551 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,743,598 S743T probably damaging Het
Acin1 A T 14: 54,664,538 V559E probably benign Het
Adamts20 A G 15: 94,338,459 F844L probably benign Het
Adcy5 C A 16: 35,298,424 D1048E probably damaging Het
Agrn A T 4: 156,175,173 C768* probably null Het
Aldh18a1 G T 19: 40,564,838 Q487K probably damaging Het
Aldh3b1 G A 19: 3,921,271 probably benign Het
Asb18 T G 1: 89,968,580 D246A probably benign Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
Bcl2l15 A G 3: 103,838,598 probably null Het
Cage1 T A 13: 38,023,333 K285* probably null Het
Cldn17 A G 16: 88,506,556 L95P probably damaging Het
Cldn20 A T 17: 3,532,882 D110V probably damaging Het
Cnot10 T C 9: 114,614,999 T443A probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Col23a1 T C 11: 51,527,889 Y135H unknown Het
Cse1l T C 2: 166,926,411 S210P probably damaging Het
Ctgf A C 10: 24,596,797 T202P probably damaging Het
Dip2c A G 13: 9,659,368 T1415A probably damaging Het
Epc2 A G 2: 49,532,105 Y337C probably damaging Het
Epha2 A G 4: 141,322,652 S799G probably damaging Het
Fndc10 A G 4: 155,694,898 Y133C probably damaging Het
Gli3 G T 13: 15,726,297 S1423I probably benign Het
Gm6034 A T 17: 36,043,153 probably benign Het
Gmip A G 8: 69,811,232 S109G probably damaging Het
Grik2 C A 10: 49,523,746 W296L possibly damaging Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Il6 T A 5: 30,013,492 Y46N possibly damaging Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Itga9 A G 9: 118,698,306 probably benign Het
Kcna7 T C 7: 45,406,921 V187A possibly damaging Het
Kdm5b G T 1: 134,613,181 probably benign Het
Knl1 T G 2: 119,076,334 S1635A probably damaging Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lox T G 18: 52,520,911 probably null Het
Mdc1 A G 17: 35,847,826 D366G possibly damaging Het
Meiob T C 17: 24,834,047 C344R probably damaging Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Mon2 A T 10: 123,031,097 M551K probably damaging Het
Mrps15 A G 4: 126,051,394 T125A probably benign Het
Mtmr14 A G 6: 113,253,732 H99R probably damaging Het
Mup4 A G 4: 59,960,598 M1T probably null Het
Mup5 G A 4: 61,832,370 R179* probably null Het
Ncoa3 T G 2: 166,069,301 V1326G possibly damaging Het
Noa1 A T 5: 77,307,581 N429K probably benign Het
Nrxn1 C T 17: 90,162,404 A241T probably damaging Het
Olfr331 C T 11: 58,501,939 V206M probably damaging Het
Olfr59 A T 11: 74,289,300 Y218F probably damaging Het
Pcdh9 G A 14: 93,888,035 S233L probably damaging Het
Peg3 C A 7: 6,709,901 S774I possibly damaging Het
Phyh A G 2: 4,937,809 K321R probably null Het
Plcg1 T A 2: 160,731,920 M35K probably damaging Het
Pnisr C T 4: 21,874,086 probably benign Het
Ppargc1b T A 18: 61,307,204 probably null Het
Prcd A C 11: 116,657,545 S27R probably benign Het
Prx T A 7: 27,517,523 M622K probably benign Het
Psmd1 T A 1: 86,071,845 D51E probably damaging Het
Psmd13 C T 7: 140,883,517 T38I probably damaging Het
Ptprf A C 4: 118,224,899 D1047E possibly damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Riiad1 G A 3: 94,472,869 P40S possibly damaging Het
Rnft1 T A 11: 86,486,270 N53K probably benign Het
Scn4a C T 11: 106,320,820 R1457H probably benign Het
Sema6c A T 3: 95,170,788 I492F probably damaging Het
Shbg T C 11: 69,614,972 H403R probably damaging Het
Slc15a5 A T 6: 138,072,847 probably benign Het
Slc38a1 G A 15: 96,587,135 T221M probably damaging Het
Slc6a16 T A 7: 45,261,176 V375E possibly damaging Het
Slc6a17 T A 3: 107,472,176 M559L probably damaging Het
Slmap A G 14: 26,460,218 probably benign Het
Sorcs2 G A 5: 36,026,748 R965W probably damaging Het
St8sia4 C A 1: 95,653,669 R116L probably damaging Het
Tcaf1 A C 6: 42,675,338 S737A possibly damaging Het
Thbs2 T A 17: 14,678,810 Y676F probably benign Het
Tmod2 A G 9: 75,586,042 probably benign Het
Trim75 T C 8: 64,982,739 probably null Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp54 A T 14: 20,583,440 Y37* probably null Het
Vill T C 9: 119,066,014 F100S probably damaging Het
Vstm5 A G 9: 15,257,367 R76G probably benign Het
Zfp608 T C 18: 54,899,249 T540A probably benign Het
Zfp947 A C 17: 22,146,203 N163K probably benign Het
Zfyve26 T C 12: 79,261,799 H228R possibly damaging Het
Other mutations in Cspg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Cspg4 APN 9 56898865 missense probably damaging 1.00
IGL01322:Cspg4 APN 9 56898588 missense probably damaging 1.00
IGL01922:Cspg4 APN 9 56887887 missense probably damaging 1.00
IGL01993:Cspg4 APN 9 56898478 missense probably benign 0.09
IGL02379:Cspg4 APN 9 56892609 splice site probably benign
IGL02398:Cspg4 APN 9 56886686 missense probably benign 0.43
IGL02503:Cspg4 APN 9 56897403 missense probably damaging 1.00
IGL02504:Cspg4 APN 9 56885772 missense probably benign 0.06
IGL02692:Cspg4 APN 9 56887454 missense probably benign 0.00
IGL02728:Cspg4 APN 9 56886481 missense probably damaging 1.00
IGL02806:Cspg4 APN 9 56890259 missense possibly damaging 0.57
IGL02886:Cspg4 APN 9 56897388 missense probably damaging 0.99
IGL03005:Cspg4 APN 9 56888488 missense probably damaging 1.00
IGL03008:Cspg4 APN 9 56898475 missense possibly damaging 0.48
IGL03202:Cspg4 APN 9 56897739 missense possibly damaging 0.93
chiclets UTSW 9 56885222 splice site probably null
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0254:Cspg4 UTSW 9 56897410 missense probably damaging 0.98
R0284:Cspg4 UTSW 9 56886139 missense probably damaging 0.96
R0513:Cspg4 UTSW 9 56898091 missense probably benign 0.03
R0602:Cspg4 UTSW 9 56888017 missense probably damaging 1.00
R0747:Cspg4 UTSW 9 56890280 missense probably damaging 1.00
R1005:Cspg4 UTSW 9 56888736 missense probably benign 0.13
R1421:Cspg4 UTSW 9 56896626 missense probably benign 0.00
R1443:Cspg4 UTSW 9 56886512 missense probably damaging 1.00
R1481:Cspg4 UTSW 9 56887810 missense probably damaging 0.98
R1585:Cspg4 UTSW 9 56898867 missense probably damaging 0.99
R1624:Cspg4 UTSW 9 56888470 missense probably damaging 1.00
R1670:Cspg4 UTSW 9 56897403 missense probably damaging 1.00
R1728:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1729:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1763:Cspg4 UTSW 9 56886979 missense probably damaging 0.97
R1772:Cspg4 UTSW 9 56897492 missense probably benign 0.02
R1938:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R1975:Cspg4 UTSW 9 56890478 missense probably damaging 1.00
R2064:Cspg4 UTSW 9 56896656 missense probably damaging 1.00
R2185:Cspg4 UTSW 9 56886972 missense probably benign 0.37
R2252:Cspg4 UTSW 9 56898046 missense probably damaging 1.00
R2291:Cspg4 UTSW 9 56892743 missense probably damaging 0.96
R2329:Cspg4 UTSW 9 56888550 missense probably benign 0.00
R3780:Cspg4 UTSW 9 56888233 missense probably damaging 1.00
R3830:Cspg4 UTSW 9 56897621 missense probably damaging 0.99
R3944:Cspg4 UTSW 9 56886123 missense probably damaging 1.00
R4011:Cspg4 UTSW 9 56887317 missense probably benign 0.19
R4115:Cspg4 UTSW 9 56898394 missense probably damaging 1.00
R4173:Cspg4 UTSW 9 56887930 missense probably damaging 1.00
R4243:Cspg4 UTSW 9 56887857 missense probably benign 0.12
R4329:Cspg4 UTSW 9 56892465 missense probably damaging 0.99
R4544:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4545:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4546:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4649:Cspg4 UTSW 9 56886865 missense possibly damaging 0.93
R4663:Cspg4 UTSW 9 56886676 missense possibly damaging 0.61
R4674:Cspg4 UTSW 9 56898205 missense probably damaging 1.00
R4779:Cspg4 UTSW 9 56885808 missense probably damaging 1.00
R4884:Cspg4 UTSW 9 56898069 missense probably benign 0.00
R5021:Cspg4 UTSW 9 56897730 missense probably benign 0.01
R5051:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
R5328:Cspg4 UTSW 9 56885856 missense probably benign 0.01
R5394:Cspg4 UTSW 9 56890200 missense probably damaging 1.00
R5567:Cspg4 UTSW 9 56886648 missense probably benign 0.00
R5682:Cspg4 UTSW 9 56886196 missense probably benign 0.14
R5690:Cspg4 UTSW 9 56898735 missense probably benign 0.01
R5715:Cspg4 UTSW 9 56891051 missense possibly damaging 0.90
R5717:Cspg4 UTSW 9 56885798 missense probably benign
R5726:Cspg4 UTSW 9 56885904 missense probably damaging 1.00
R5898:Cspg4 UTSW 9 56885222 splice site probably null
R6140:Cspg4 UTSW 9 56897224 missense probably benign 0.35
R6147:Cspg4 UTSW 9 56888772 missense probably damaging 0.99
R6239:Cspg4 UTSW 9 56888182 missense probably benign 0.04
R6343:Cspg4 UTSW 9 56892692 missense probably benign
R6351:Cspg4 UTSW 9 56892644 missense probably benign 0.00
R6564:Cspg4 UTSW 9 56890158 missense probably benign 0.02
R6814:Cspg4 UTSW 9 56890340 missense possibly damaging 0.91
R6928:Cspg4 UTSW 9 56897880 missense possibly damaging 0.95
R6967:Cspg4 UTSW 9 56890136 missense possibly damaging 0.52
R6981:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R7033:Cspg4 UTSW 9 56888074 missense probably damaging 0.96
R7419:Cspg4 UTSW 9 56888443 missense possibly damaging 0.94
R7809:Cspg4 UTSW 9 56890190 missense probably damaging 1.00
X0065:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
Z1088:Cspg4 UTSW 9 56886036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATTGACACTGCTGTGCTCC -3'
(R):5'- GGTGCGTGACACTTAACAGGTAGG -3'

Sequencing Primer
(F):5'- ACCATGTAACCGCTGGTC -3'
(R):5'- AACAGGTAGGTGTATGTTCCTAGAC -3'
Posted On2014-05-14