Mutagenetix > Incidental Mutation

Incidental Mutation 'R1721:Gli3'

191490

Institutional Source

Beutler Lab

Gene Symbol

Gli3

Ensembl Gene

ENSMUSG00000021318

Gene Name

GLI-Kruppel family member GLI3

Synonyms

brachyphalangy, Bph

MMRRC Submission

039753-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1721 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15463235-15730026 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 15726297 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 1423 (S1423I)

Ref Sequence

ENSEMBL: ENSMUSP00000106137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110510]

AlphaFold

Q61602

Predicted Effect

probably benign
Transcript: ENSMUST00000110510
AA Change: S1423I

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: S1423I

Domain	Start	End	E-Value	Type
low complexity region	120	136	N/A	INTRINSIC
low complexity region	204	220	N/A	INTRINSIC
low complexity region	324	341	N/A	INTRINSIC
low complexity region	403	421	N/A	INTRINSIC
ZnF_C2H2	480	505	1.53e-1	SMART
ZnF_C2H2	513	540	1.23e0	SMART
ZnF_C2H2	546	570	3.16e-3	SMART
ZnF_C2H2	576	601	4.17e-3	SMART
ZnF_C2H2	607	632	1.4e-4	SMART
low complexity region	703	726	N/A	INTRINSIC
low complexity region	756	763	N/A	INTRINSIC
low complexity region	849	880	N/A	INTRINSIC
low complexity region	934	944	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1081	1095	N/A	INTRINSIC
low complexity region	1166	1175	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	T	19: 29,743,598	S743T	probably damaging	Het
Acin1	A	T	14: 54,664,538	V559E	probably benign	Het
Adamts20	A	G	15: 94,338,459	F844L	probably benign	Het
Adcy5	C	A	16: 35,298,424	D1048E	probably damaging	Het
Agrn	A	T	4: 156,175,173	C768*	probably null	Het
Aldh18a1	G	T	19: 40,564,838	Q487K	probably damaging	Het
Aldh3b1	G	A	19: 3,921,271		probably benign	Het
Asb18	T	G	1: 89,968,580	D246A	probably benign	Het
Atp2b1	T	C	10: 98,996,888	V417A	probably damaging	Het
Bcl2l15	A	G	3: 103,838,598		probably null	Het
Cage1	T	A	13: 38,023,333	K285*	probably null	Het
Cldn17	A	G	16: 88,506,556	L95P	probably damaging	Het
Cldn20	A	T	17: 3,532,882	D110V	probably damaging	Het
Cnot10	T	C	9: 114,614,999	T443A	probably benign	Het
Col14a1	T	A	15: 55,447,462		probably benign	Het
Col23a1	T	C	11: 51,527,889	Y135H	unknown	Het
Cse1l	T	C	2: 166,926,411	S210P	probably damaging	Het
Cspg4	T	G	9: 56,888,743	V1254G	probably damaging	Het
Ctgf	A	C	10: 24,596,797	T202P	probably damaging	Het
Dip2c	A	G	13: 9,659,368	T1415A	probably damaging	Het
Epc2	A	G	2: 49,532,105	Y337C	probably damaging	Het
Epha2	A	G	4: 141,322,652	S799G	probably damaging	Het
Fndc10	A	G	4: 155,694,898	Y133C	probably damaging	Het
Gm6034	A	T	17: 36,043,153		probably benign	Het
Gmip	A	G	8: 69,811,232	S109G	probably damaging	Het
Grik2	C	A	10: 49,523,746	W296L	possibly damaging	Het
Gucy2d	T	A	7: 98,454,061	L504H	probably damaging	Het
Il6	T	A	5: 30,013,492	Y46N	possibly damaging	Het
Ints8	C	A	4: 11,241,684	C253F	probably damaging	Het
Itga9	A	G	9: 118,698,306		probably benign	Het
Kcna7	T	C	7: 45,406,921	V187A	possibly damaging	Het
Kdm5b	G	T	1: 134,613,181		probably benign	Het
Knl1	T	G	2: 119,076,334	S1635A	probably damaging	Het
Lce1b	A	G	3: 92,656,011	S72P	unknown	Het
Lox	T	G	18: 52,520,911		probably null	Het
Mdc1	A	G	17: 35,847,826	D366G	possibly damaging	Het
Meiob	T	C	17: 24,834,047	C344R	probably damaging	Het
Mier2	A	G	10: 79,548,830	V150A	probably damaging	Het
Mon2	A	T	10: 123,031,097	M551K	probably damaging	Het
Mrps15	A	G	4: 126,051,394	T125A	probably benign	Het
Mtmr14	A	G	6: 113,253,732	H99R	probably damaging	Het
Mup4	A	G	4: 59,960,598	M1T	probably null	Het
Mup5	G	A	4: 61,832,370	R179*	probably null	Het
Ncoa3	T	G	2: 166,069,301	V1326G	possibly damaging	Het
Noa1	A	T	5: 77,307,581	N429K	probably benign	Het
Nrxn1	C	T	17: 90,162,404	A241T	probably damaging	Het
Olfr331	C	T	11: 58,501,939	V206M	probably damaging	Het
Olfr59	A	T	11: 74,289,300	Y218F	probably damaging	Het
Pcdh9	G	A	14: 93,888,035	S233L	probably damaging	Het
Peg3	C	A	7: 6,709,901	S774I	possibly damaging	Het
Phyh	A	G	2: 4,937,809	K321R	probably null	Het
Plcg1	T	A	2: 160,731,920	M35K	probably damaging	Het
Pnisr	C	T	4: 21,874,086		probably benign	Het
Ppargc1b	T	A	18: 61,307,204		probably null	Het
Prcd	A	C	11: 116,657,545	S27R	probably benign	Het
Prx	T	A	7: 27,517,523	M622K	probably benign	Het
Psmd1	T	A	1: 86,071,845	D51E	probably damaging	Het
Psmd13	C	T	7: 140,883,517	T38I	probably damaging	Het
Ptprf	A	C	4: 118,224,899	D1047E	possibly damaging	Het
Rai14	C	A	15: 10,633,228	Q25H	probably damaging	Het
Riiad1	G	A	3: 94,472,869	P40S	possibly damaging	Het
Rnft1	T	A	11: 86,486,270	N53K	probably benign	Het
Scn4a	C	T	11: 106,320,820	R1457H	probably benign	Het
Sema6c	A	T	3: 95,170,788	I492F	probably damaging	Het
Shbg	T	C	11: 69,614,972	H403R	probably damaging	Het
Slc15a5	A	T	6: 138,072,847		probably benign	Het
Slc38a1	G	A	15: 96,587,135	T221M	probably damaging	Het
Slc6a16	T	A	7: 45,261,176	V375E	possibly damaging	Het
Slc6a17	T	A	3: 107,472,176	M559L	probably damaging	Het
Slmap	A	G	14: 26,460,218		probably benign	Het
Sorcs2	G	A	5: 36,026,748	R965W	probably damaging	Het
St8sia4	C	A	1: 95,653,669	R116L	probably damaging	Het
Tcaf1	A	C	6: 42,675,338	S737A	possibly damaging	Het
Thbs2	T	A	17: 14,678,810	Y676F	probably benign	Het
Tmod2	A	G	9: 75,586,042		probably benign	Het
Trim75	T	C	8: 64,982,739		probably null	Het
Ubr5	A	T	15: 38,041,846	S169T	probably benign	Het
Usp54	A	T	14: 20,583,440	Y37*	probably null	Het
Vill	T	C	9: 119,066,014	F100S	probably damaging	Het
Vstm5	A	G	9: 15,257,367	R76G	probably benign	Het
Zfp608	T	C	18: 54,899,249	T540A	probably benign	Het
Zfp947	A	C	17: 22,146,203	N163K	probably benign	Het
Zfyve26	T	C	12: 79,261,799	H228R	possibly damaging	Het

Other mutations in Gli3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Gli3	APN	13	15644299	missense	probably damaging	1.00
IGL00471:Gli3	APN	13	15723769	critical splice donor site	probably null
IGL00484:Gli3	APN	13	15644392	missense	possibly damaging	0.84
IGL00588:Gli3	APN	13	15644392	missense	possibly damaging	0.84
IGL01161:Gli3	APN	13	15548398	critical splice acceptor site	probably null
IGL01633:Gli3	APN	13	15648634	missense	probably damaging	1.00
IGL01799:Gli3	APN	13	15726161	missense	probably benign	0.00
IGL01861:Gli3	APN	13	15725325	missense	probably damaging	1.00
IGL02063:Gli3	APN	13	15726372	missense	possibly damaging	0.94
IGL02112:Gli3	APN	13	15662514	missense	probably damaging	1.00
IGL02255:Gli3	APN	13	15648719	missense	probably damaging	1.00
IGL02270:Gli3	APN	13	15726786	utr 3 prime	probably benign
IGL02336:Gli3	APN	13	15720289	missense	probably damaging	1.00
IGL02346:Gli3	APN	13	15723693	missense	probably damaging	1.00
IGL02744:Gli3	APN	13	15613886	critical splice donor site	probably null
IGL02877:Gli3	APN	13	15724742	missense	probably damaging	1.00
IGL02975:Gli3	APN	13	15724568	missense	probably damaging	1.00
IGL03018:Gli3	APN	13	15660132	missense	probably damaging	1.00
IGL03378:Gli3	APN	13	15644420	missense	probably damaging	1.00
IGL03406:Gli3	APN	13	15648581	missense	probably damaging	1.00
Capone	UTSW	13	15715034	missense	probably damaging	1.00
Carpals	UTSW	13	15713650	critical splice donor site	probably null
Ness	UTSW	13	15723555	missense	probably damaging	1.00
FR4737:Gli3	UTSW	13	15644357	missense	probably damaging	1.00
R0110:Gli3	UTSW	13	15724785	missense	probably damaging	1.00
R0329:Gli3	UTSW	13	15723558	missense	probably damaging	0.98
R0330:Gli3	UTSW	13	15723558	missense	probably damaging	0.98
R0360:Gli3	UTSW	13	15724764	missense	probably benign	0.32
R0364:Gli3	UTSW	13	15724764	missense	probably benign	0.32
R0469:Gli3	UTSW	13	15724785	missense	probably damaging	1.00
R0616:Gli3	UTSW	13	15662406	missense	possibly damaging	0.75
R0639:Gli3	UTSW	13	15724715	missense	probably damaging	1.00
R1072:Gli3	UTSW	13	15713605	missense	probably damaging	1.00
R1257:Gli3	UTSW	13	15725996	nonsense	probably null
R1270:Gli3	UTSW	13	15723744	missense	probably benign	0.02
R1424:Gli3	UTSW	13	15726314	missense	probably benign	0.00
R1481:Gli3	UTSW	13	15613850	missense	probably damaging	0.99
R1596:Gli3	UTSW	13	15725471	missense	possibly damaging	0.74
R1628:Gli3	UTSW	13	15726312	missense	probably benign	0.00
R1797:Gli3	UTSW	13	15713512	missense	probably damaging	0.99
R1813:Gli3	UTSW	13	15648691	missense	probably damaging	1.00
R1819:Gli3	UTSW	13	15725792	nonsense	probably null
R1988:Gli3	UTSW	13	15726380	missense	probably benign
R2132:Gli3	UTSW	13	15725549	missense	possibly damaging	0.74
R2352:Gli3	UTSW	13	15662392	missense	probably benign	0.02
R3085:Gli3	UTSW	13	15660941	missense	probably damaging	1.00
R3177:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R3277:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R4162:Gli3	UTSW	13	15725115	missense	possibly damaging	0.93
R4497:Gli3	UTSW	13	15723571	missense	possibly damaging	0.74
R4526:Gli3	UTSW	13	15713631	missense	probably damaging	1.00
R4979:Gli3	UTSW	13	15724464	missense	possibly damaging	0.87
R5327:Gli3	UTSW	13	15548507	missense	probably damaging	0.99
R5395:Gli3	UTSW	13	15714950	missense	probably damaging	1.00
R5494:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R5609:Gli3	UTSW	13	15548453	missense	possibly damaging	0.82
R5718:Gli3	UTSW	13	15478165	critical splice donor site	probably null
R5810:Gli3	UTSW	13	15644309	missense	probably damaging	0.99
R5896:Gli3	UTSW	13	15726180	missense	probably benign	0.00
R5930:Gli3	UTSW	13	15548625	missense	probably damaging	1.00
R5964:Gli3	UTSW	13	15726162	nonsense	probably null
R5985:Gli3	UTSW	13	15723555	missense	probably damaging	1.00
R6224:Gli3	UTSW	13	15725145	missense	probably benign
R6278:Gli3	UTSW	13	15725113	missense	possibly damaging	0.69
R6330:Gli3	UTSW	13	15724732	missense	probably damaging	1.00
R6383:Gli3	UTSW	13	15723555	missense	probably damaging	1.00
R6523:Gli3	UTSW	13	15713650	critical splice donor site	probably null
R7072:Gli3	UTSW	13	15725695	missense	possibly damaging	0.51
R7085:Gli3	UTSW	13	15715062	missense	probably damaging	1.00
R7228:Gli3	UTSW	13	15724502	missense	probably benign	0.00
R7327:Gli3	UTSW	13	15725559	missense	probably benign	0.02
R7451:Gli3	UTSW	13	15726291	missense	possibly damaging	0.50
R7974:Gli3	UTSW	13	15726256	missense	probably benign	0.00
R8167:Gli3	UTSW	13	15725643	missense	probably benign	0.00
R8170:Gli3	UTSW	13	15720208	missense	probably benign
R8199:Gli3	UTSW	13	15725991	missense	probably benign	0.08
R8247:Gli3	UTSW	13	15726775	missense	possibly damaging	0.82
R8332:Gli3	UTSW	13	15713548	missense	possibly damaging	0.58
R8347:Gli3	UTSW	13	15723525	missense	probably damaging	1.00
R8559:Gli3	UTSW	13	15660132	missense	probably damaging	1.00
R8676:Gli3	UTSW	13	15715034	missense	probably damaging	1.00
R8905:Gli3	UTSW	13	15726531	missense	probably benign	0.01
R9099:Gli3	UTSW	13	15726735	missense	probably damaging	1.00
R9260:Gli3	UTSW	13	15725090	missense	probably damaging	0.99
R9317:Gli3	UTSW	13	15715073	missense	probably damaging	1.00
R9475:Gli3	UTSW	13	15725711	missense	possibly damaging	0.87
R9546:Gli3	UTSW	13	15613858	missense	probably benign	0.00
R9571:Gli3	UTSW	13	15726273	missense	probably benign	0.00
R9621:Gli3	UTSW	13	15726668	missense	probably benign	0.01
R9704:Gli3	UTSW	13	15723473	missense	probably damaging	1.00
R9787:Gli3	UTSW	13	15725801	missense	probably damaging	0.96
RF010:Gli3	UTSW	13	15726369	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCAAGGGACAGAGAGCTGCCTAC -3'
(R):5'- GCTGTCAACTGTGCTTGTTACCTGG -3'

Sequencing Primer
(F):5'- TGCCTACCAGGGACTCAG -3'
(R):5'- GAGTAACTCAGAGTTTTCAGTGCC -3'

Posted On

2014-05-14