Incidental Mutation 'R1721:Acin1'
ID191494
Institutional Source Beutler Lab
Gene Symbol Acin1
Ensembl Gene ENSMUSG00000022185
Gene Nameapoptotic chromatin condensation inducer 1
Synonyms2610510L13Rik, Acinus, 2610036I19Rik
MMRRC Submission 039753-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R1721 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54642161-54686931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54664538 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 559 (V559E)
Ref Sequence ENSEMBL: ENSMUSP00000107109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022793] [ENSMUST00000111484] [ENSMUST00000125265]
Predicted Effect probably benign
Transcript: ENSMUST00000022793
AA Change: V599E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022793
Gene: ENSMUSG00000022185
AA Change: V599E

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 175 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 414 423 N/A INTRINSIC
low complexity region 573 603 N/A INTRINSIC
low complexity region 631 662 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
low complexity region 760 773 N/A INTRINSIC
low complexity region 778 792 N/A INTRINSIC
low complexity region 803 813 N/A INTRINSIC
internal_repeat_1 817 892 1.63e-6 PROSPERO
low complexity region 927 952 N/A INTRINSIC
RRM 1012 1081 8.3e-2 SMART
Pfam:RSB_motif 1139 1246 5.7e-30 PFAM
low complexity region 1275 1329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111484
AA Change: V559E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185
AA Change: V559E

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125265
SMART Domains Protein: ENSMUSP00000120445
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
Blast:BRLZ 1 27 3e-9 BLAST
coiled coil region 32 66 N/A INTRINSIC
coiled coil region 113 154 N/A INTRINSIC
low complexity region 232 250 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141993
Predicted Effect unknown
Transcript: ENSMUST00000147714
AA Change: V544E
SMART Domains Protein: ENSMUSP00000119080
Gene: ENSMUSG00000022185
AA Change: V544E

DomainStartEndE-ValueType
SAP 18 52 1.29e-8 SMART
coiled coil region 83 120 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
coiled coil region 204 245 N/A INTRINSIC
low complexity region 324 342 N/A INTRINSIC
low complexity region 360 369 N/A INTRINSIC
low complexity region 519 549 N/A INTRINSIC
low complexity region 577 608 N/A INTRINSIC
low complexity region 680 689 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
low complexity region 861 886 N/A INTRINSIC
RRM 946 1015 8.3e-2 SMART
Pfam:RSB_motif 1065 1180 1.1e-29 PFAM
low complexity region 1209 1263 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,743,598 S743T probably damaging Het
Adamts20 A G 15: 94,338,459 F844L probably benign Het
Adcy5 C A 16: 35,298,424 D1048E probably damaging Het
Agrn A T 4: 156,175,173 C768* probably null Het
Aldh18a1 G T 19: 40,564,838 Q487K probably damaging Het
Aldh3b1 G A 19: 3,921,271 probably benign Het
Asb18 T G 1: 89,968,580 D246A probably benign Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
Bcl2l15 A G 3: 103,838,598 probably null Het
Cage1 T A 13: 38,023,333 K285* probably null Het
Cldn17 A G 16: 88,506,556 L95P probably damaging Het
Cldn20 A T 17: 3,532,882 D110V probably damaging Het
Cnot10 T C 9: 114,614,999 T443A probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Col23a1 T C 11: 51,527,889 Y135H unknown Het
Cse1l T C 2: 166,926,411 S210P probably damaging Het
Cspg4 T G 9: 56,888,743 V1254G probably damaging Het
Ctgf A C 10: 24,596,797 T202P probably damaging Het
Dip2c A G 13: 9,659,368 T1415A probably damaging Het
Epc2 A G 2: 49,532,105 Y337C probably damaging Het
Epha2 A G 4: 141,322,652 S799G probably damaging Het
Fndc10 A G 4: 155,694,898 Y133C probably damaging Het
Gli3 G T 13: 15,726,297 S1423I probably benign Het
Gm6034 A T 17: 36,043,153 probably benign Het
Gmip A G 8: 69,811,232 S109G probably damaging Het
Grik2 C A 10: 49,523,746 W296L possibly damaging Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Il6 T A 5: 30,013,492 Y46N possibly damaging Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Itga9 A G 9: 118,698,306 probably benign Het
Kcna7 T C 7: 45,406,921 V187A possibly damaging Het
Kdm5b G T 1: 134,613,181 probably benign Het
Knl1 T G 2: 119,076,334 S1635A probably damaging Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lox T G 18: 52,520,911 probably null Het
Mdc1 A G 17: 35,847,826 D366G possibly damaging Het
Meiob T C 17: 24,834,047 C344R probably damaging Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Mon2 A T 10: 123,031,097 M551K probably damaging Het
Mrps15 A G 4: 126,051,394 T125A probably benign Het
Mtmr14 A G 6: 113,253,732 H99R probably damaging Het
Mup4 A G 4: 59,960,598 M1T probably null Het
Mup5 G A 4: 61,832,370 R179* probably null Het
Ncoa3 T G 2: 166,069,301 V1326G possibly damaging Het
Noa1 A T 5: 77,307,581 N429K probably benign Het
Nrxn1 C T 17: 90,162,404 A241T probably damaging Het
Olfr331 C T 11: 58,501,939 V206M probably damaging Het
Olfr59 A T 11: 74,289,300 Y218F probably damaging Het
Pcdh9 G A 14: 93,888,035 S233L probably damaging Het
Peg3 C A 7: 6,709,901 S774I possibly damaging Het
Phyh A G 2: 4,937,809 K321R probably null Het
Plcg1 T A 2: 160,731,920 M35K probably damaging Het
Pnisr C T 4: 21,874,086 probably benign Het
Ppargc1b T A 18: 61,307,204 probably null Het
Prcd A C 11: 116,657,545 S27R probably benign Het
Prx T A 7: 27,517,523 M622K probably benign Het
Psmd1 T A 1: 86,071,845 D51E probably damaging Het
Psmd13 C T 7: 140,883,517 T38I probably damaging Het
Ptprf A C 4: 118,224,899 D1047E possibly damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Riiad1 G A 3: 94,472,869 P40S possibly damaging Het
Rnft1 T A 11: 86,486,270 N53K probably benign Het
Scn4a C T 11: 106,320,820 R1457H probably benign Het
Sema6c A T 3: 95,170,788 I492F probably damaging Het
Shbg T C 11: 69,614,972 H403R probably damaging Het
Slc15a5 A T 6: 138,072,847 probably benign Het
Slc38a1 G A 15: 96,587,135 T221M probably damaging Het
Slc6a16 T A 7: 45,261,176 V375E possibly damaging Het
Slc6a17 T A 3: 107,472,176 M559L probably damaging Het
Slmap A G 14: 26,460,218 probably benign Het
Sorcs2 G A 5: 36,026,748 R965W probably damaging Het
St8sia4 C A 1: 95,653,669 R116L probably damaging Het
Tcaf1 A C 6: 42,675,338 S737A possibly damaging Het
Thbs2 T A 17: 14,678,810 Y676F probably benign Het
Tmod2 A G 9: 75,586,042 probably benign Het
Trim75 T C 8: 64,982,739 probably null Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp54 A T 14: 20,583,440 Y37* probably null Het
Vill T C 9: 119,066,014 F100S probably damaging Het
Vstm5 A G 9: 15,257,367 R76G probably benign Het
Zfp608 T C 18: 54,899,249 T540A probably benign Het
Zfp947 A C 17: 22,146,203 N163K probably benign Het
Zfyve26 T C 12: 79,261,799 H228R possibly damaging Het
Other mutations in Acin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Acin1 APN 14 54646800 missense probably damaging 1.00
IGL01530:Acin1 APN 14 54643986 missense probably damaging 1.00
IGL02396:Acin1 APN 14 54644799 intron probably benign
IGL02967:Acin1 APN 14 54642753 missense possibly damaging 0.80
Protuberant UTSW 14 54645283 missense probably damaging 1.00
R0411:Acin1 UTSW 14 54646774 missense probably damaging 1.00
R0723:Acin1 UTSW 14 54665451 missense probably damaging 0.98
R0755:Acin1 UTSW 14 54651835 start codon destroyed probably null 0.93
R0784:Acin1 UTSW 14 54653528 unclassified probably benign
R1600:Acin1 UTSW 14 54643717 intron probably benign
R1682:Acin1 UTSW 14 54663718 missense probably damaging 1.00
R1756:Acin1 UTSW 14 54665204 missense probably benign 0.30
R1867:Acin1 UTSW 14 54644261 missense probably damaging 1.00
R1997:Acin1 UTSW 14 54646699 splice site probably null
R2067:Acin1 UTSW 14 54665254 missense probably damaging 1.00
R3947:Acin1 UTSW 14 54679333 missense possibly damaging 0.89
R4374:Acin1 UTSW 14 54653894 unclassified probably benign
R4476:Acin1 UTSW 14 54645330 missense probably damaging 1.00
R4501:Acin1 UTSW 14 54686587 missense probably damaging 1.00
R4547:Acin1 UTSW 14 54645667 missense probably benign 0.01
R4621:Acin1 UTSW 14 54653443 unclassified probably benign
R4657:Acin1 UTSW 14 54643047 missense possibly damaging 0.93
R4680:Acin1 UTSW 14 54686758 missense probably benign 0.00
R4696:Acin1 UTSW 14 54643017 intron probably benign
R4806:Acin1 UTSW 14 54679228 splice site probably benign
R4826:Acin1 UTSW 14 54664617 missense probably damaging 0.97
R5096:Acin1 UTSW 14 54679222 intron probably benign
R5153:Acin1 UTSW 14 54645613 missense probably benign 0.25
R5223:Acin1 UTSW 14 54642941 frame shift probably null
R5260:Acin1 UTSW 14 54642822 intron probably benign
R5525:Acin1 UTSW 14 54664391 missense possibly damaging 0.94
R5575:Acin1 UTSW 14 54678738 splice site probably null
R5902:Acin1 UTSW 14 54663673 missense probably benign 0.01
R6211:Acin1 UTSW 14 54644046 missense probably damaging 1.00
R6524:Acin1 UTSW 14 54645283 missense probably damaging 1.00
R6560:Acin1 UTSW 14 54678833 missense probably benign 0.24
R6916:Acin1 UTSW 14 54665416 missense probably benign 0.27
R7201:Acin1 UTSW 14 54664899 missense possibly damaging 0.83
R7833:Acin1 UTSW 14 54664602 missense possibly damaging 0.83
R7916:Acin1 UTSW 14 54664602 missense possibly damaging 0.83
X0021:Acin1 UTSW 14 54667101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGCCCTGACTCTGTAATGAAG -3'
(R):5'- TGCCAAAGGCATCACTGAGGAAC -3'

Sequencing Primer
(F):5'- CCCTGACTCTGTAATGAAGGAAAAG -3'
(R):5'- GGCATCACTGAGGAACCTATG -3'
Posted On2014-05-14