Mutagenetix > Incidental Mutations

Incidental Mutation 'R1721:Adamts20'

191499

Institutional Source

Beutler Lab

Gene Symbol

Adamts20

Ensembl Gene

ENSMUSG00000022449

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20

Synonyms

ADAMTS-20, bt

MMRRC Submission

039753-MU

Accession Numbers

Genbank: NM_177431; MGI: 2660628

Is this an essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R1721 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94270163-94465418 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94338459 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 844 (F844L)

Ref Sequence

ENSEMBL: ENSMUSP00000121696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035342] [ENSMUST00000155907]

Predicted Effect

probably benign
Transcript: ENSMUST00000035342
AA Change: F844L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: F844L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	186	1.4e-30	PFAM
Pfam:Reprolysin_5	253	445	3.6e-13	PFAM
Pfam:Reprolysin_4	253	460	1.1e-7	PFAM
Pfam:Reprolysin	255	464	1.5e-26	PFAM
Pfam:Reprolysin_2	272	454	1.8e-10	PFAM
Pfam:Reprolysin_3	276	410	5.8e-10	PFAM
TSP1	556	608	7.73e-11	SMART
Pfam:ADAM_spacer1	718	836	2.6e-34	PFAM
TSP1	846	901	1.47e-1	SMART
TSP1	904	958	2.83e0	SMART
TSP1	965	1019	4.28e-4	SMART
TSP1	1020	1074	1.89e-5	SMART
TSP1	1075	1131	4.87e-8	SMART
TSP1	1152	1201	6.05e-4	SMART
TSP1	1204	1260	1.22e-8	SMART
TSP1	1304	1356	1.37e-2	SMART
TSP1	1357	1411	6e-8	SMART
TSP1	1416	1470	1.69e-2	SMART
TSP1	1471	1526	2.3e0	SMART
TSP1	1530	1579	1.23e0	SMART
TSP1	1653	1706	5.27e-4	SMART
Pfam:GON	1708	1905	5.8e-80	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155907
AA Change: F844L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000121696
Gene: ENSMUSG00000022449
AA Change: F844L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Pep_M12B_propep	40	186	1e-31	PFAM
Pfam:Reprolysin_5	253	445	2.7e-13	PFAM
Pfam:Reprolysin_4	253	460	7.2e-8	PFAM
Pfam:Reprolysin	255	464	2.4e-28	PFAM
Pfam:Reprolysin_2	272	454	4e-10	PFAM
Pfam:Reprolysin_3	276	410	1.1e-10	PFAM
TSP1	556	608	7.73e-11	SMART
Pfam:ADAM_spacer1	718	836	2e-34	PFAM
TSP1	846	901	1.47e-1	SMART
TSP1	904	958	2.83e0	SMART
TSP1	965	1019	4.28e-4	SMART
TSP1	1020	1074	1.89e-5	SMART
TSP1	1075	1131	4.87e-8	SMART
TSP1	1152	1201	6.05e-4	SMART
TSP1	1204	1260	1.22e-8	SMART
TSP1	1304	1356	1.37e-2	SMART
TSP1	1357	1411	6e-8	SMART

Meta Mutation Damage Score

0.0965

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]

Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	T	19: 29,743,598	S743T	probably damaging	Het
Acin1	A	T	14: 54,664,538	V559E	probably benign	Het
Adcy5	C	A	16: 35,298,424	D1048E	probably damaging	Het
Agrn	A	T	4: 156,175,173	C768*	probably null	Het
Aldh18a1	G	T	19: 40,564,838	Q487K	probably damaging	Het
Aldh3b1	G	A	19: 3,921,271		probably benign	Het
Asb18	T	G	1: 89,968,580	D246A	probably benign	Het
Atp2b1	T	C	10: 98,996,888	V417A	probably damaging	Het
Bcl2l15	A	G	3: 103,838,598		probably null	Het
Cage1	T	A	13: 38,023,333	K285*	probably null	Het
Cldn17	A	G	16: 88,506,556	L95P	probably damaging	Het
Cldn20	A	T	17: 3,532,882	D110V	probably damaging	Het
Cnot10	T	C	9: 114,614,999	T443A	probably benign	Het
Col14a1	T	A	15: 55,447,462		probably benign	Het
Col23a1	T	C	11: 51,527,889	Y135H	unknown	Het
Cse1l	T	C	2: 166,926,411	S210P	probably damaging	Het
Cspg4	T	G	9: 56,888,743	V1254G	probably damaging	Het
Ctgf	A	C	10: 24,596,797	T202P	probably damaging	Het
Dip2c	A	G	13: 9,659,368	T1415A	probably damaging	Het
Epc2	A	G	2: 49,532,105	Y337C	probably damaging	Het
Epha2	A	G	4: 141,322,652	S799G	probably damaging	Het
Fndc10	A	G	4: 155,694,898	Y133C	probably damaging	Het
Gli3	G	T	13: 15,726,297	S1423I	probably benign	Het
Gm6034	A	T	17: 36,043,153		probably benign	Het
Gmip	A	G	8: 69,811,232	S109G	probably damaging	Het
Grik2	C	A	10: 49,523,746	W296L	possibly damaging	Het
Gucy2d	T	A	7: 98,454,061	L504H	probably damaging	Het
Il6	T	A	5: 30,013,492	Y46N	possibly damaging	Het
Ints8	C	A	4: 11,241,684	C253F	probably damaging	Het
Itga9	A	G	9: 118,698,306		probably benign	Het
Kcna7	T	C	7: 45,406,921	V187A	possibly damaging	Het
Kdm5b	G	T	1: 134,613,181		probably benign	Het
Knl1	T	G	2: 119,076,334	S1635A	probably damaging	Het
Lce1b	A	G	3: 92,656,011	S72P	unknown	Het
Lox	T	G	18: 52,520,911		probably null	Het
Mdc1	A	G	17: 35,847,826	D366G	possibly damaging	Het
Meiob	T	C	17: 24,834,047	C344R	probably damaging	Het
Mier2	A	G	10: 79,548,830	V150A	probably damaging	Het
Mon2	A	T	10: 123,031,097	M551K	probably damaging	Het
Mrps15	A	G	4: 126,051,394	T125A	probably benign	Het
Mtmr14	A	G	6: 113,253,732	H99R	probably damaging	Het
Mup4	A	G	4: 59,960,598	M1T	probably null	Het
Mup5	G	A	4: 61,832,370	R179*	probably null	Het
Ncoa3	T	G	2: 166,069,301	V1326G	possibly damaging	Het
Noa1	A	T	5: 77,307,581	N429K	probably benign	Het
Nrxn1	C	T	17: 90,162,404	A241T	probably damaging	Het
Olfr331	C	T	11: 58,501,939	V206M	probably damaging	Het
Olfr59	A	T	11: 74,289,300	Y218F	probably damaging	Het
Pcdh9	G	A	14: 93,888,035	S233L	probably damaging	Het
Peg3	C	A	7: 6,709,901	S774I	possibly damaging	Het
Phyh	A	G	2: 4,937,809	K321R	probably null	Het
Plcg1	T	A	2: 160,731,920	M35K	probably damaging	Het
Pnisr	C	T	4: 21,874,086		probably benign	Het
Ppargc1b	T	A	18: 61,307,204		probably null	Het
Prcd	A	C	11: 116,657,545	S27R	probably benign	Het
Prx	T	A	7: 27,517,523	M622K	probably benign	Het
Psmd1	T	A	1: 86,071,845	D51E	probably damaging	Het
Psmd13	C	T	7: 140,883,517	T38I	probably damaging	Het
Ptprf	A	C	4: 118,224,899	D1047E	possibly damaging	Het
Rai14	C	A	15: 10,633,228	Q25H	probably damaging	Het
Riiad1	G	A	3: 94,472,869	P40S	possibly damaging	Het
Rnft1	T	A	11: 86,486,270	N53K	probably benign	Het
Scn4a	C	T	11: 106,320,820	R1457H	probably benign	Het
Sema6c	A	T	3: 95,170,788	I492F	probably damaging	Het
Shbg	T	C	11: 69,614,972	H403R	probably damaging	Het
Slc15a5	A	T	6: 138,072,847		probably benign	Het
Slc38a1	G	A	15: 96,587,135	T221M	probably damaging	Het
Slc6a16	T	A	7: 45,261,176	V375E	possibly damaging	Het
Slc6a17	T	A	3: 107,472,176	M559L	probably damaging	Het
Slmap	A	G	14: 26,460,218		probably benign	Het
Sorcs2	G	A	5: 36,026,748	R965W	probably damaging	Het
St8sia4	C	A	1: 95,653,669	R116L	probably damaging	Het
Tcaf1	A	C	6: 42,675,338	S737A	possibly damaging	Het
Thbs2	T	A	17: 14,678,810	Y676F	probably benign	Het
Tmod2	A	G	9: 75,586,042		probably benign	Het
Trim75	T	C	8: 64,982,739		probably null	Het
Ubr5	A	T	15: 38,041,846	S169T	probably benign	Het
Usp54	A	T	14: 20,583,440	Y37*	probably null	Het
Vill	T	C	9: 119,066,014	F100S	probably damaging	Het
Vstm5	A	G	9: 15,257,367	R76G	probably benign	Het
Zfp608	T	C	18: 54,899,249	T540A	probably benign	Het
Zfp947	A	C	17: 22,146,203	N163K	probably benign	Het
Zfyve26	T	C	12: 79,261,799	H228R	possibly damaging	Het

Other mutations in Adamts20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Adamts20	APN	15	94394641	missense	probably benign
IGL00491:Adamts20	APN	15	94273232	missense	possibly damaging	0.89
IGL00502:Adamts20	APN	15	94403397	missense	probably damaging	0.99
IGL00672:Adamts20	APN	15	94341105	missense	probably damaging	0.99
IGL00840:Adamts20	APN	15	94282482	missense	probably damaging	1.00
IGL00909:Adamts20	APN	15	94379813	missense	probably damaging	1.00
IGL01101:Adamts20	APN	15	94344042	missense	probably damaging	1.00
IGL01137:Adamts20	APN	15	94394611	critical splice donor site	probably null
IGL01457:Adamts20	APN	15	94331448	missense	probably damaging	0.97
IGL01685:Adamts20	APN	15	94403446	missense	possibly damaging	0.81
IGL01949:Adamts20	APN	15	94326106	missense	probably benign	0.08
IGL02525:Adamts20	APN	15	94283078	splice site	probably null
IGL03088:Adamts20	APN	15	94329914	critical splice donor site	probably null
IGL03175:Adamts20	APN	15	94273255	nonsense	probably null
belt	UTSW	15	94345990	missense	probably damaging	1.00
buckeye	UTSW	15	94341087	missense	probably damaging	1.00
jack_white	UTSW	15		unclassified
Meowth	UTSW	15	94331458	missense	probably damaging	1.00
nidoking	UTSW	15	94403445	missense	probably damaging	1.00
panda	UTSW	15	94326699	intron	probably benign
pikachu	UTSW	15	94345990	missense	probably damaging	1.00
poliwag	UTSW	15	94394622	nonsense	probably null
splotch2	UTSW	15	94335561	intron	probably benign
wash	UTSW	15	94347670	nonsense	probably null
whitebelly	UTSW	15		unclassified
whopper	UTSW	15	94347810	missense	probably damaging	1.00
R0483:Adamts20	UTSW	15	94353571	missense	probably benign	0.00
R0514:Adamts20	UTSW	15	94270376	missense	probably damaging	1.00
R0568:Adamts20	UTSW	15	94291713	splice site	probably benign
R0730:Adamts20	UTSW	15	94347690	missense	probably benign	0.00
R0973:Adamts20	UTSW	15	94286371	missense	probably benign	0.00
R1339:Adamts20	UTSW	15	94322896	missense	probably benign	0.19
R1809:Adamts20	UTSW	15	94341087	missense	probably damaging	1.00
R1832:Adamts20	UTSW	15	94286344	missense	probably benign	0.00
R1846:Adamts20	UTSW	15	94345990	missense	probably damaging	1.00
R1867:Adamts20	UTSW	15	94338459	missense	probably benign	0.44
R1875:Adamts20	UTSW	15	94331396	missense	probably benign	0.01
R1930:Adamts20	UTSW	15	94404010	missense	probably benign	0.03
R1931:Adamts20	UTSW	15	94404010	missense	probably benign	0.03
R1932:Adamts20	UTSW	15	94404010	missense	probably benign	0.03
R2001:Adamts20	UTSW	15	94347718	missense	possibly damaging	0.96
R2116:Adamts20	UTSW	15	94355362	missense	probably damaging	1.00
R2162:Adamts20	UTSW	15	94331458	missense	probably damaging	1.00
R2350:Adamts20	UTSW	15	94283916	missense	probably damaging	1.00
R2887:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R2889:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R2890:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R3109:Adamts20	UTSW	15	94345904	splice site	probably benign
R3719:Adamts20	UTSW	15	94361838	missense	probably damaging	0.99
R3832:Adamts20	UTSW	15	94331458	missense	probably damaging	1.00
R3901:Adamts20	UTSW	15	94328845	missense	possibly damaging	0.81
R4398:Adamts20	UTSW	15	94333695	missense	possibly damaging	0.93
R4402:Adamts20	UTSW	15	94379946	missense	probably benign
R4431:Adamts20	UTSW	15	94344043	missense	probably damaging	1.00
R4479:Adamts20	UTSW	15	94403445	missense	probably damaging	1.00
R4482:Adamts20	UTSW	15	94345920	missense	probably damaging	1.00
R4503:Adamts20	UTSW	15	94379750	missense	probably damaging	0.99
R4671:Adamts20	UTSW	15	94403325	missense	possibly damaging	0.48
R4700:Adamts20	UTSW	15	94394622	nonsense	probably null
R4707:Adamts20	UTSW	15	94333647	missense	possibly damaging	0.53
R4725:Adamts20	UTSW	15	94351762	missense	probably damaging	0.99
R4771:Adamts20	UTSW	15	94351635	splice site	probably null
R4829:Adamts20	UTSW	15	94326396	missense	probably benign	0.01
R4937:Adamts20	UTSW	15	94379775	missense	probably benign
R4960:Adamts20	UTSW	15	94379774	missense	probably benign
R5270:Adamts20	UTSW	15	94282519	missense	probably benign	0.00
R5388:Adamts20	UTSW	15	94345778	missense	possibly damaging	0.81
R5410:Adamts20	UTSW	15	94281957	missense	possibly damaging	0.94
R5453:Adamts20	UTSW	15	94326088	missense	possibly damaging	0.69
R5611:Adamts20	UTSW	15	94273280	missense	possibly damaging	0.65
R5687:Adamts20	UTSW	15	94325971	missense	probably benign	0.36
R5758:Adamts20	UTSW	15	94394650	missense	probably benign	0.00
R5801:Adamts20	UTSW	15	94347670	nonsense	probably null
R5834:Adamts20	UTSW	15	94353584	missense	probably damaging	0.99
R5993:Adamts20	UTSW	15	94338723	missense	probably damaging	0.99
R5997:Adamts20	UTSW	15	94379747	missense	probably damaging	1.00
R6044:Adamts20	UTSW	15	94282483	missense	probably damaging	1.00
R6058:Adamts20	UTSW	15	94330047	nonsense	probably null
R6217:Adamts20	UTSW	15	94338715	missense	probably benign	0.00
R6283:Adamts20	UTSW	15	94351721	missense	probably benign
R6354:Adamts20	UTSW	15	94347810	missense	probably damaging	1.00
R6415:Adamts20	UTSW	15	94324659	critical splice donor site	probably null
R6419:Adamts20	UTSW	15	94333675	missense	possibly damaging	0.84
R6476:Adamts20	UTSW	15	94361810	missense	probably benign	0.22
R6485:Adamts20	UTSW	15	94343971	missense	probably benign	0.17
R6517:Adamts20	UTSW	15	94283104	intron	probably null
R6675:Adamts20	UTSW	15	94331316	critical splice donor site	probably null
R6863:Adamts20	UTSW	15	94379746	nonsense	probably null
R7186:Adamts20	UTSW	15	94322808	missense	possibly damaging	0.76
R7263:Adamts20	UTSW	15	94322891	missense	possibly damaging	0.52
R7441:Adamts20	UTSW	15	94353673	missense	probably damaging	1.00
R7519:Adamts20	UTSW	15	94325988	missense	possibly damaging	0.64
R7747:Adamts20	UTSW	15	94291587	nonsense	probably null
R7770:Adamts20	UTSW	15	94333698	missense	probably benign	0.02
R7816:Adamts20	UTSW	15	94322844	missense	probably benign	0.00
R7827:Adamts20	UTSW	15	94325933	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGACAGGGTACGTTGCAAGC -3'
(R):5'- AGAATTAACAGCACGGACCGGC -3'

Sequencing Primer
(F):5'- AAGCCCGTGTGCTCTGTG -3'
(R):5'- CTAACGGCTAGTAGGCAGC -3'

Posted On

2014-05-14