Mutagenetix > Incidental Mutations

Incidental Mutation 'R1721:Thbs2'

191504

Institutional Source

Beutler Lab

Gene Symbol

Thbs2

Ensembl Gene

ENSMUSG00000023885

Gene Name

thrombospondin 2

Synonyms

Thbs-2, Thrombospondin-2, TSP2

MMRRC Submission

039753-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.164) question?

Stock #

R1721 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14665500-14694235 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14678810 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 676 (Y676F)

Ref Sequence

ENSEMBL: ENSMUSP00000128308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170872]

Predicted Effect

probably benign
Transcript: ENSMUST00000170872
AA Change: Y676F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: Y676F

Domain	Start	End	E-Value	Type
low complexity region	2	10	N/A	INTRINSIC
TSPN	21	215	3.8e-60	SMART
VWC	320	374	3.55e-19	SMART
TSP1	384	431	3.36e-11	SMART
TSP1	440	492	1.35e-15	SMART
TSP1	497	549	8.6e-18	SMART
EGF	552	589	6.3e-3	SMART
EGF	593	647	1.56e1	SMART
EGF	651	692	2.19e-2	SMART
Pfam:TSP_3	729	764	2.5e-12	PFAM
Pfam:TSP_3	763	787	7.4e-7	PFAM
Pfam:TSP_3	788	823	9.4e-12	PFAM
Pfam:TSP_3	823	846	4.1e-7	PFAM
Pfam:TSP_3	847	884	1.7e-12	PFAM
Pfam:TSP_3	885	920	1.3e-11	PFAM
Pfam:TSP_3	921	956	3.1e-11	PFAM
Pfam:TSP_C	974	1171	1e-98	PFAM

Meta Mutation Damage Score

0.0903

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	T	19: 29,743,598	S743T	probably damaging	Het
Acin1	A	T	14: 54,664,538	V559E	probably benign	Het
Adamts20	A	G	15: 94,338,459	F844L	probably benign	Het
Adcy5	C	A	16: 35,298,424	D1048E	probably damaging	Het
Agrn	A	T	4: 156,175,173	C768*	probably null	Het
Aldh18a1	G	T	19: 40,564,838	Q487K	probably damaging	Het
Aldh3b1	G	A	19: 3,921,271		probably benign	Het
Asb18	T	G	1: 89,968,580	D246A	probably benign	Het
Atp2b1	T	C	10: 98,996,888	V417A	probably damaging	Het
Bcl2l15	A	G	3: 103,838,598		probably null	Het
Cage1	T	A	13: 38,023,333	K285*	probably null	Het
Cldn17	A	G	16: 88,506,556	L95P	probably damaging	Het
Cldn20	A	T	17: 3,532,882	D110V	probably damaging	Het
Cnot10	T	C	9: 114,614,999	T443A	probably benign	Het
Col14a1	T	A	15: 55,447,462		probably benign	Het
Col23a1	T	C	11: 51,527,889	Y135H	unknown	Het
Cse1l	T	C	2: 166,926,411	S210P	probably damaging	Het
Cspg4	T	G	9: 56,888,743	V1254G	probably damaging	Het
Ctgf	A	C	10: 24,596,797	T202P	probably damaging	Het
Dip2c	A	G	13: 9,659,368	T1415A	probably damaging	Het
Epc2	A	G	2: 49,532,105	Y337C	probably damaging	Het
Epha2	A	G	4: 141,322,652	S799G	probably damaging	Het
Fndc10	A	G	4: 155,694,898	Y133C	probably damaging	Het
Gli3	G	T	13: 15,726,297	S1423I	probably benign	Het
Gm6034	A	T	17: 36,043,153		probably benign	Het
Gmip	A	G	8: 69,811,232	S109G	probably damaging	Het
Grik2	C	A	10: 49,523,746	W296L	possibly damaging	Het
Gucy2d	T	A	7: 98,454,061	L504H	probably damaging	Het
Il6	T	A	5: 30,013,492	Y46N	possibly damaging	Het
Ints8	C	A	4: 11,241,684	C253F	probably damaging	Het
Itga9	A	G	9: 118,698,306		probably benign	Het
Kcna7	T	C	7: 45,406,921	V187A	possibly damaging	Het
Kdm5b	G	T	1: 134,613,181		probably benign	Het
Knl1	T	G	2: 119,076,334	S1635A	probably damaging	Het
Lce1b	A	G	3: 92,656,011	S72P	unknown	Het
Lox	T	G	18: 52,520,911		probably null	Het
Mdc1	A	G	17: 35,847,826	D366G	possibly damaging	Het
Meiob	T	C	17: 24,834,047	C344R	probably damaging	Het
Mier2	A	G	10: 79,548,830	V150A	probably damaging	Het
Mon2	A	T	10: 123,031,097	M551K	probably damaging	Het
Mrps15	A	G	4: 126,051,394	T125A	probably benign	Het
Mtmr14	A	G	6: 113,253,732	H99R	probably damaging	Het
Mup4	A	G	4: 59,960,598	M1T	probably null	Het
Mup5	G	A	4: 61,832,370	R179*	probably null	Het
Ncoa3	T	G	2: 166,069,301	V1326G	possibly damaging	Het
Noa1	A	T	5: 77,307,581	N429K	probably benign	Het
Nrxn1	C	T	17: 90,162,404	A241T	probably damaging	Het
Olfr331	C	T	11: 58,501,939	V206M	probably damaging	Het
Olfr59	A	T	11: 74,289,300	Y218F	probably damaging	Het
Pcdh9	G	A	14: 93,888,035	S233L	probably damaging	Het
Peg3	C	A	7: 6,709,901	S774I	possibly damaging	Het
Phyh	A	G	2: 4,937,809	K321R	probably null	Het
Plcg1	T	A	2: 160,731,920	M35K	probably damaging	Het
Pnisr	C	T	4: 21,874,086		probably benign	Het
Ppargc1b	T	A	18: 61,307,204		probably null	Het
Prcd	A	C	11: 116,657,545	S27R	probably benign	Het
Prx	T	A	7: 27,517,523	M622K	probably benign	Het
Psmd1	T	A	1: 86,071,845	D51E	probably damaging	Het
Psmd13	C	T	7: 140,883,517	T38I	probably damaging	Het
Ptprf	A	C	4: 118,224,899	D1047E	possibly damaging	Het
Rai14	C	A	15: 10,633,228	Q25H	probably damaging	Het
Riiad1	G	A	3: 94,472,869	P40S	possibly damaging	Het
Rnft1	T	A	11: 86,486,270	N53K	probably benign	Het
Scn4a	C	T	11: 106,320,820	R1457H	probably benign	Het
Sema6c	A	T	3: 95,170,788	I492F	probably damaging	Het
Shbg	T	C	11: 69,614,972	H403R	probably damaging	Het
Slc15a5	A	T	6: 138,072,847		probably benign	Het
Slc38a1	G	A	15: 96,587,135	T221M	probably damaging	Het
Slc6a16	T	A	7: 45,261,176	V375E	possibly damaging	Het
Slc6a17	T	A	3: 107,472,176	M559L	probably damaging	Het
Slmap	A	G	14: 26,460,218		probably benign	Het
Sorcs2	G	A	5: 36,026,748	R965W	probably damaging	Het
St8sia4	C	A	1: 95,653,669	R116L	probably damaging	Het
Tcaf1	A	C	6: 42,675,338	S737A	possibly damaging	Het
Tmod2	A	G	9: 75,586,042		probably benign	Het
Trim75	T	C	8: 64,982,739		probably null	Het
Ubr5	A	T	15: 38,041,846	S169T	probably benign	Het
Usp54	A	T	14: 20,583,440	Y37*	probably null	Het
Vill	T	C	9: 119,066,014	F100S	probably damaging	Het
Vstm5	A	G	9: 15,257,367	R76G	probably benign	Het
Zfp608	T	C	18: 54,899,249	T540A	probably benign	Het
Zfp947	A	C	17: 22,146,203	N163K	probably benign	Het
Zfyve26	T	C	12: 79,261,799	H228R	possibly damaging	Het

Other mutations in Thbs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Thbs2	APN	17	14668835	missense	probably damaging	1.00
IGL00764:Thbs2	APN	17	14690252	missense	probably damaging	0.98
IGL01370:Thbs2	APN	17	14690065	missense	possibly damaging	0.82
IGL01604:Thbs2	APN	17	14678769	missense	probably benign	0.31
IGL01936:Thbs2	APN	17	14687814	missense	probably benign	0.00
IGL02061:Thbs2	APN	17	14679914	missense	probably benign	0.35
IGL02255:Thbs2	APN	17	14689785	missense	probably benign	0.00
IGL02342:Thbs2	APN	17	14676316	missense	probably damaging	1.00
IGL02402:Thbs2	APN	17	14671454	missense	probably benign	0.01
IGL02499:Thbs2	APN	17	14684066	splice site	probably benign
IGL02572:Thbs2	APN	17	14677013	missense	possibly damaging	0.72
IGL02701:Thbs2	APN	17	14683361	missense	probably benign	0.05
IGL02871:Thbs2	APN	17	14685786	missense	probably benign
IGL03058:Thbs2	APN	17	14689969	missense	possibly damaging	0.91
IGL03185:Thbs2	APN	17	14681410	nonsense	probably null
IGL03232:Thbs2	APN	17	14691413	start codon destroyed	probably null
IGL03289:Thbs2	APN	17	14690122	missense	probably benign	0.00
IGL03407:Thbs2	APN	17	14673273	missense	probably benign	0.00
H8562:Thbs2	UTSW	17	14671453	missense	probably benign	0.00
IGL02802:Thbs2	UTSW	17	14684127	missense	probably benign	0.01
PIT4354001:Thbs2	UTSW	17	14689968	missense	probably damaging	0.99
R0088:Thbs2	UTSW	17	14681701	missense	possibly damaging	0.96
R0167:Thbs2	UTSW	17	14667525	splice site	probably benign
R0415:Thbs2	UTSW	17	14679973	missense	probably benign
R0658:Thbs2	UTSW	17	14680325	missense	probably benign	0.00
R0735:Thbs2	UTSW	17	14679815	missense	probably benign	0.00
R1582:Thbs2	UTSW	17	14671288	missense	probably damaging	1.00
R1585:Thbs2	UTSW	17	14689768	missense	probably benign	0.00
R1608:Thbs2	UTSW	17	14685781	missense	probably benign
R1724:Thbs2	UTSW	17	14685900	missense	possibly damaging	0.80
R1791:Thbs2	UTSW	17	14685813	missense	probably benign
R1816:Thbs2	UTSW	17	14670713	missense	probably benign	0.01
R1816:Thbs2	UTSW	17	14670714	missense	probably benign	0.00
R1911:Thbs2	UTSW	17	14689842	missense	probably benign	0.38
R2137:Thbs2	UTSW	17	14673306	missense	probably damaging	1.00
R2152:Thbs2	UTSW	17	14673209	missense	probably damaging	1.00
R2244:Thbs2	UTSW	17	14671413	missense	probably damaging	1.00
R2325:Thbs2	UTSW	17	14690289	splice site	probably null
R2509:Thbs2	UTSW	17	14685843	missense	probably benign	0.11
R3838:Thbs2	UTSW	17	14687851	missense	probably benign
R4173:Thbs2	UTSW	17	14681631	intron	probably null
R4427:Thbs2	UTSW	17	14680335	missense	probably benign
R4495:Thbs2	UTSW	17	14671413	missense	probably damaging	1.00
R4789:Thbs2	UTSW	17	14671488	missense	probably damaging	1.00
R4928:Thbs2	UTSW	17	14678900	missense	probably damaging	1.00
R5058:Thbs2	UTSW	17	14676329	missense	probably damaging	1.00
R5112:Thbs2	UTSW	17	14670590	splice site	probably null
R5619:Thbs2	UTSW	17	14681244	missense	probably damaging	1.00
R5649:Thbs2	UTSW	17	14689953	missense	probably damaging	1.00
R5664:Thbs2	UTSW	17	14689837	missense	probably damaging	1.00
R5801:Thbs2	UTSW	17	14687863	missense	probably damaging	1.00
R5816:Thbs2	UTSW	17	14684071	critical splice donor site	probably null
R5840:Thbs2	UTSW	17	14681430	splice site	probably null
R6149:Thbs2	UTSW	17	14679680	critical splice donor site	probably null
R6166:Thbs2	UTSW	17	14680388	missense	probably damaging	1.00
R6412:Thbs2	UTSW	17	14677077	missense	probably damaging	1.00
R6473:Thbs2	UTSW	17	14685796	missense	probably benign	0.23
R6640:Thbs2	UTSW	17	14673368	missense	possibly damaging	0.94
R6695:Thbs2	UTSW	17	14674164	missense	possibly damaging	0.54
R6711:Thbs2	UTSW	17	14690265	missense	probably benign	0.00
R6947:Thbs2	UTSW	17	14689767	missense	possibly damaging	0.79
R6962:Thbs2	UTSW	17	14681820	missense	probably benign	0.00
R7183:Thbs2	UTSW	17	14690116	missense	possibly damaging	0.90
R7203:Thbs2	UTSW	17	14671458	missense	probably damaging	1.00
R7386:Thbs2	UTSW	17	14673150	missense	possibly damaging	0.95
R7621:Thbs2	UTSW	17	14674164	missense	probably benign
R7747:Thbs2	UTSW	17	14670039	missense	possibly damaging	0.94
R7759:Thbs2	UTSW	17	14677059	missense	probably damaging	1.00
R7800:Thbs2	UTSW	17	14676296	missense	probably damaging	1.00
R7895:Thbs2	UTSW	17	14676221	missense	probably damaging	1.00
R7978:Thbs2	UTSW	17	14676221	missense	probably damaging	1.00
S24628:Thbs2	UTSW	17	14679973	missense	probably benign
X0025:Thbs2	UTSW	17	14681800	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AGCTCTTAGCCTGAGGTGACTGTG -3'
(R):5'- TGAAGTTGGAGGGTCCCTGATGAC -3'

Sequencing Primer
(F):5'- GTGACTCTCACCTTGATGCAG -3'
(R):5'- GAGGGTCCCTGATGACTATACAC -3'

Posted On

2014-05-14