Incidental Mutation 'R1721:Lox'
ID191510
Institutional Source Beutler Lab
Gene Symbol Lox
Ensembl Gene ENSMUSG00000024529
Gene Namelysyl oxidase
SynonymsTSC-160, ras recision gene (rrg)
MMRRC Submission 039753-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1721 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location52516069-52529867 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to G at 52520911 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025409] [ENSMUST00000025409] [ENSMUST00000171470] [ENSMUST00000171470]
Predicted Effect probably null
Transcript: ENSMUST00000025409
SMART Domains Protein: ENSMUSP00000025409
Gene: ENSMUSG00000024529

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 107 116 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
low complexity region 163 184 N/A INTRINSIC
Pfam:Lysyl_oxidase 207 411 2.3e-121 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000025409
SMART Domains Protein: ENSMUSP00000025409
Gene: ENSMUSG00000024529

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 107 116 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
low complexity region 163 184 N/A INTRINSIC
Pfam:Lysyl_oxidase 207 411 2.3e-121 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171470
SMART Domains Protein: ENSMUSP00000129247
Gene: ENSMUSG00000024529

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 107 116 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
low complexity region 163 184 N/A INTRINSIC
Pfam:Lysyl_oxidase 207 408 3.7e-96 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171470
SMART Domains Protein: ENSMUSP00000129247
Gene: ENSMUSG00000024529

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 107 116 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
low complexity region 163 184 N/A INTRINSIC
Pfam:Lysyl_oxidase 207 408 3.7e-96 PFAM
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that belongs to the lysyl oxidase family of proteins. The secreted proprotein is proteolytically processed to an active mature peptide and a propeptide. This propeptide is thought to function in tumor suppression by inhibiting the Ras signaling pathway. The active enzyme plays a role in cross-linking of collagen and elastin and is essential for development of cardiovascular and respiratory systems, and development of skin and connective tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to altered arterial wall structure, aortic aneurysms, cardiovascular dysfunction, diaphragmatic hernia, and perinatal death. Abnormal development of the respiratory system, and elastic and collagen fiber abnormalities in the lung and skin are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,743,598 S743T probably damaging Het
Acin1 A T 14: 54,664,538 V559E probably benign Het
Adamts20 A G 15: 94,338,459 F844L probably benign Het
Adcy5 C A 16: 35,298,424 D1048E probably damaging Het
Agrn A T 4: 156,175,173 C768* probably null Het
Aldh18a1 G T 19: 40,564,838 Q487K probably damaging Het
Aldh3b1 G A 19: 3,921,271 probably benign Het
Asb18 T G 1: 89,968,580 D246A probably benign Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
Bcl2l15 A G 3: 103,838,598 probably null Het
Cage1 T A 13: 38,023,333 K285* probably null Het
Cldn17 A G 16: 88,506,556 L95P probably damaging Het
Cldn20 A T 17: 3,532,882 D110V probably damaging Het
Cnot10 T C 9: 114,614,999 T443A probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Col23a1 T C 11: 51,527,889 Y135H unknown Het
Cse1l T C 2: 166,926,411 S210P probably damaging Het
Cspg4 T G 9: 56,888,743 V1254G probably damaging Het
Ctgf A C 10: 24,596,797 T202P probably damaging Het
Dip2c A G 13: 9,659,368 T1415A probably damaging Het
Epc2 A G 2: 49,532,105 Y337C probably damaging Het
Epha2 A G 4: 141,322,652 S799G probably damaging Het
Fndc10 A G 4: 155,694,898 Y133C probably damaging Het
Gli3 G T 13: 15,726,297 S1423I probably benign Het
Gm6034 A T 17: 36,043,153 probably benign Het
Gmip A G 8: 69,811,232 S109G probably damaging Het
Grik2 C A 10: 49,523,746 W296L possibly damaging Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Il6 T A 5: 30,013,492 Y46N possibly damaging Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Itga9 A G 9: 118,698,306 probably benign Het
Kcna7 T C 7: 45,406,921 V187A possibly damaging Het
Kdm5b G T 1: 134,613,181 probably benign Het
Knl1 T G 2: 119,076,334 S1635A probably damaging Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Mdc1 A G 17: 35,847,826 D366G possibly damaging Het
Meiob T C 17: 24,834,047 C344R probably damaging Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Mon2 A T 10: 123,031,097 M551K probably damaging Het
Mrps15 A G 4: 126,051,394 T125A probably benign Het
Mtmr14 A G 6: 113,253,732 H99R probably damaging Het
Mup4 A G 4: 59,960,598 M1T probably null Het
Mup5 G A 4: 61,832,370 R179* probably null Het
Ncoa3 T G 2: 166,069,301 V1326G possibly damaging Het
Noa1 A T 5: 77,307,581 N429K probably benign Het
Nrxn1 C T 17: 90,162,404 A241T probably damaging Het
Olfr331 C T 11: 58,501,939 V206M probably damaging Het
Olfr59 A T 11: 74,289,300 Y218F probably damaging Het
Pcdh9 G A 14: 93,888,035 S233L probably damaging Het
Peg3 C A 7: 6,709,901 S774I possibly damaging Het
Phyh A G 2: 4,937,809 K321R probably null Het
Plcg1 T A 2: 160,731,920 M35K probably damaging Het
Pnisr C T 4: 21,874,086 probably benign Het
Ppargc1b T A 18: 61,307,204 probably null Het
Prcd A C 11: 116,657,545 S27R probably benign Het
Prx T A 7: 27,517,523 M622K probably benign Het
Psmd1 T A 1: 86,071,845 D51E probably damaging Het
Psmd13 C T 7: 140,883,517 T38I probably damaging Het
Ptprf A C 4: 118,224,899 D1047E possibly damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Riiad1 G A 3: 94,472,869 P40S possibly damaging Het
Rnft1 T A 11: 86,486,270 N53K probably benign Het
Scn4a C T 11: 106,320,820 R1457H probably benign Het
Sema6c A T 3: 95,170,788 I492F probably damaging Het
Shbg T C 11: 69,614,972 H403R probably damaging Het
Slc15a5 A T 6: 138,072,847 probably benign Het
Slc38a1 G A 15: 96,587,135 T221M probably damaging Het
Slc6a16 T A 7: 45,261,176 V375E possibly damaging Het
Slc6a17 T A 3: 107,472,176 M559L probably damaging Het
Slmap A G 14: 26,460,218 probably benign Het
Sorcs2 G A 5: 36,026,748 R965W probably damaging Het
St8sia4 C A 1: 95,653,669 R116L probably damaging Het
Tcaf1 A C 6: 42,675,338 S737A possibly damaging Het
Thbs2 T A 17: 14,678,810 Y676F probably benign Het
Tmod2 A G 9: 75,586,042 probably benign Het
Trim75 T C 8: 64,982,739 probably null Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp54 A T 14: 20,583,440 Y37* probably null Het
Vill T C 9: 119,066,014 F100S probably damaging Het
Vstm5 A G 9: 15,257,367 R76G probably benign Het
Zfp608 T C 18: 54,899,249 T540A probably benign Het
Zfp947 A C 17: 22,146,203 N163K probably benign Het
Zfyve26 T C 12: 79,261,799 H228R possibly damaging Het
Other mutations in Lox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Lox APN 18 52520854 missense possibly damaging 0.74
IGL02457:Lox APN 18 52521316 missense probably damaging 1.00
IGL02665:Lox APN 18 52525244 splice site probably benign
R0040:Lox UTSW 18 52520826 missense possibly damaging 0.91
R0383:Lox UTSW 18 52529199 missense possibly damaging 0.50
R0658:Lox UTSW 18 52528883 missense probably benign 0.00
R1391:Lox UTSW 18 52528819 missense probably damaging 0.99
R1794:Lox UTSW 18 52528307 missense probably damaging 1.00
R3122:Lox UTSW 18 52525105 missense probably damaging 0.97
R5436:Lox UTSW 18 52529103 missense probably benign
R5679:Lox UTSW 18 52528917 missense probably benign 0.00
R6739:Lox UTSW 18 52526959 missense possibly damaging 0.95
R7679:Lox UTSW 18 52525106 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCAAGTATGATTGCCCTCCAGGTAAG -3'
(R):5'- TTGGGGAGATCTACACAACTTCCTTTTG -3'

Sequencing Primer
(F):5'- agaaagaaaggaggaaagaaagaaag -3'
(R):5'- ACAACTTCCTTTTGTAATATCTCCAG -3'
Posted On2014-05-14