Incidental Mutation 'R1722:Hoxd13'
ID191524
Institutional Source Beutler Lab
Gene Symbol Hoxd13
Ensembl Gene ENSMUSG00000001819
Gene Namehomeobox D13
SynonymsHox-4.8, spdh
MMRRC Submission 039754-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #R1722 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location74668310-74671599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74670045 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 310 (N310S)
Ref Sequence ENSEMBL: ENSMUSP00000001872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001872] [ENSMUST00000001878]
Predicted Effect probably benign
Transcript: ENSMUST00000001872
AA Change: N310S

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000001872
Gene: ENSMUSG00000001819
AA Change: N310S

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:HoxA13_N 75 177 4e-18 PFAM
HOX 272 334 4.33e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000001878
SMART Domains Protein: ENSMUSP00000001878
Gene: ENSMUSG00000001823

DomainStartEndE-ValueType
HOX 200 262 4.57e-21 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. Mutations in this particular gene cause synpolydactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit abnormalities of the axial skeleton, especially limbs, and of the male accessory organs, and agenesis of the preputial glands. Mutant males are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A T 2: 103,993,928 probably null Het
Adssl1 A T 12: 112,636,481 I346F possibly damaging Het
Ahnak T A 19: 9,010,655 L3101H probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Angptl1 C T 1: 156,857,085 P275S possibly damaging Het
Apoa5 C T 9: 46,270,549 Q308* probably null Het
Arhgef12 T C 9: 43,020,717 *106W probably null Het
Atp2c1 A G 9: 105,439,400 Y485H probably benign Het
Atp6v1b1 C T 6: 83,743,092 T3I possibly damaging Het
Btbd7 A T 12: 102,812,654 I451N possibly damaging Het
Clasp1 T G 1: 118,590,464 L1080R probably damaging Het
Clec4f A G 6: 83,646,933 V408A probably benign Het
Clint1 T A 11: 45,906,406 M438K possibly damaging Het
Cuzd1 A T 7: 131,311,644 Y415N probably damaging Het
Ddias A G 7: 92,860,042 F222L possibly damaging Het
Efcab7 A T 4: 99,900,618 T321S probably benign Het
Elp3 A T 14: 65,551,397 D393E probably benign Het
Fbn2 T C 18: 58,048,052 probably null Het
Fcgr3 T C 1: 171,054,119 R146G possibly damaging Het
Fkrp G A 7: 16,810,794 A381V probably benign Het
Gatad2b T G 3: 90,355,679 I476S probably damaging Het
Gm1527 C T 3: 28,921,634 H557Y probably benign Het
Gm2431 A T 7: 142,257,862 C102S unknown Het
Il9 T A 13: 56,479,395 T135S probably benign Het
Ints4 A C 7: 97,513,579 N476T probably benign Het
Kcnq4 A C 4: 120,702,427 D525E probably benign Het
Kncn A T 4: 115,885,899 Y57F probably damaging Het
Lpl TGG TG 8: 68,896,602 probably null Het
Lrrfip2 A G 9: 111,199,761 T351A probably damaging Het
Madd T C 2: 91,167,637 E682G probably benign Het
March7 A C 2: 60,234,182 R267S probably damaging Het
Mmp16 T A 4: 18,051,767 L252Q probably damaging Het
Mri1 A T 8: 84,253,925 V296D possibly damaging Het
Myo3a A G 2: 22,399,827 T665A probably benign Het
N4bp2 T C 5: 65,806,882 V758A probably benign Het
Nbea T C 3: 55,665,695 D2489G probably damaging Het
Neb T C 2: 52,256,745 T2836A probably damaging Het
Nedd4l T A 18: 65,157,939 V203E probably damaging Het
Nkpd1 C A 7: 19,523,921 Q392K possibly damaging Het
Nploc4 G T 11: 120,382,569 A576E probably benign Het
Nxph1 T A 6: 9,247,516 N162K probably damaging Het
Olfr1356 T A 10: 78,846,971 T315S probably benign Het
Olfr410 T C 11: 74,334,445 Y262C probably damaging Het
Pabpc2 T G 18: 39,775,116 I478S probably benign Het
Pde7b G T 10: 20,436,244 H190Q probably damaging Het
Plekha2 A T 8: 25,042,960 S332T probably benign Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl11a A T 5: 146,845,242 H9L probably benign Het
Rer1 A T 4: 155,075,001 F177I probably damaging Het
Rinl T C 7: 28,792,244 L74P probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rttn T C 18: 88,973,531 V78A probably benign Het
Skint5 A T 4: 113,846,311 probably null Het
Tenm2 A C 11: 36,008,103 Y2743D probably damaging Het
Tmem101 T C 11: 102,154,693 Y110C probably damaging Het
Trim9 T C 12: 70,248,374 N658S probably benign Het
Ucp1 A T 8: 83,290,688 T36S probably benign Het
Vmn2r43 A G 7: 8,255,068 I382T probably damaging Het
Zfp142 C T 1: 74,569,776 R1620Q probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Other mutations in Hoxd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03108:Hoxd13 APN 2 74670096 missense probably damaging 1.00
R2163:Hoxd13 UTSW 2 74669069 missense possibly damaging 0.82
R4116:Hoxd13 UTSW 2 74668488 missense possibly damaging 0.93
R4400:Hoxd13 UTSW 2 74670015 missense probably damaging 1.00
R4424:Hoxd13 UTSW 2 74669957 nonsense probably null
R4938:Hoxd13 UTSW 2 74668683 missense probably benign 0.26
R5535:Hoxd13 UTSW 2 74668797 missense probably damaging 0.99
R7054:Hoxd13 UTSW 2 74669025 missense probably damaging 1.00
R7069:Hoxd13 UTSW 2 74669024 missense probably damaging 1.00
R7677:Hoxd13 UTSW 2 74668565 missense probably benign 0.39
R8329:Hoxd13 UTSW 2 74668317 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCCCTGCTGTTGTTTATGCTAGGAG -3'
(R):5'- GGGAAAAGGATTCACAATGCTTGCC -3'

Sequencing Primer
(F):5'- GCTAGGAGATGTGGCTTTAAACC -3'
(R):5'- CTTTCTAGGCAGGGAAGGGG -3'
Posted On2014-05-14