Incidental Mutation 'R1722:Gatad2b'
ID191528
Institutional Source Beutler Lab
Gene Symbol Gatad2b
Ensembl Gene ENSMUSG00000042390
Gene NameGATA zinc finger domain containing 2B
Synonymsp66beta, C430014D17Rik
MMRRC Submission 039754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1722 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location90293178-90363407 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 90355679 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 476 (I476S)
Ref Sequence ENSEMBL: ENSMUSP00000142514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049382] [ENSMUST00000197988] [ENSMUST00000199607] [ENSMUST00000199754]
Predicted Effect probably damaging
Transcript: ENSMUST00000049382
AA Change: I476S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041370
Gene: ENSMUSG00000042390
AA Change: I476S

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
Pfam:P66_CC 158 201 1.7e-21 PFAM
low complexity region 341 361 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
Pfam:GATA 421 455 1e-11 PFAM
coiled coil region 456 478 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196212
Predicted Effect probably damaging
Transcript: ENSMUST00000197988
AA Change: I460S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143085
Gene: ENSMUSG00000042390
AA Change: I460S

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
coiled coil region 158 194 N/A INTRINSIC
low complexity region 325 345 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
Pfam:GATA 405 439 9.3e-11 PFAM
coiled coil region 440 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199607
AA Change: I476S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142617
Gene: ENSMUSG00000042390
AA Change: I476S

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
coiled coil region 158 194 N/A INTRINSIC
low complexity region 341 361 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
Pfam:GATA 421 455 7.8e-11 PFAM
coiled coil region 456 478 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199754
AA Change: I476S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142514
Gene: ENSMUSG00000042390
AA Change: I476S

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
coiled coil region 158 194 N/A INTRINSIC
low complexity region 341 361 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
Pfam:GATA 421 455 7.8e-11 PFAM
coiled coil region 456 478 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200373
Predicted Effect unknown
Transcript: ENSMUST00000206907
AA Change: I226S
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein transcriptional repressor. The encoded protein is part of the methyl-CpG-binding protein-1 complex, which represses gene expression by deacetylating methylated nucleosomes. Mutations in this gene are linked to intellectual disability and dysmorphic features associated with mental retardation. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A T 2: 103,993,928 probably null Het
Adssl1 A T 12: 112,636,481 I346F possibly damaging Het
Ahnak T A 19: 9,010,655 L3101H probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Angptl1 C T 1: 156,857,085 P275S possibly damaging Het
Apoa5 C T 9: 46,270,549 Q308* probably null Het
Arhgef12 T C 9: 43,020,717 *106W probably null Het
Atp2c1 A G 9: 105,439,400 Y485H probably benign Het
Atp6v1b1 C T 6: 83,743,092 T3I possibly damaging Het
Btbd7 A T 12: 102,812,654 I451N possibly damaging Het
Clasp1 T G 1: 118,590,464 L1080R probably damaging Het
Clec4f A G 6: 83,646,933 V408A probably benign Het
Clint1 T A 11: 45,906,406 M438K possibly damaging Het
Cuzd1 A T 7: 131,311,644 Y415N probably damaging Het
Ddias A G 7: 92,860,042 F222L possibly damaging Het
Efcab7 A T 4: 99,900,618 T321S probably benign Het
Elp3 A T 14: 65,551,397 D393E probably benign Het
Fbn2 T C 18: 58,048,052 probably null Het
Fcgr3 T C 1: 171,054,119 R146G possibly damaging Het
Fkrp G A 7: 16,810,794 A381V probably benign Het
Gm1527 C T 3: 28,921,634 H557Y probably benign Het
Gm2431 A T 7: 142,257,862 C102S unknown Het
Hoxd13 A G 2: 74,670,045 N310S probably benign Het
Il9 T A 13: 56,479,395 T135S probably benign Het
Ints4 A C 7: 97,513,579 N476T probably benign Het
Kcnq4 A C 4: 120,702,427 D525E probably benign Het
Kncn A T 4: 115,885,899 Y57F probably damaging Het
Lpl TGG TG 8: 68,896,602 probably null Het
Lrrfip2 A G 9: 111,199,761 T351A probably damaging Het
Madd T C 2: 91,167,637 E682G probably benign Het
March7 A C 2: 60,234,182 R267S probably damaging Het
Mmp16 T A 4: 18,051,767 L252Q probably damaging Het
Mri1 A T 8: 84,253,925 V296D possibly damaging Het
Myo3a A G 2: 22,399,827 T665A probably benign Het
N4bp2 T C 5: 65,806,882 V758A probably benign Het
Nbea T C 3: 55,665,695 D2489G probably damaging Het
Neb T C 2: 52,256,745 T2836A probably damaging Het
Nedd4l T A 18: 65,157,939 V203E probably damaging Het
Nkpd1 C A 7: 19,523,921 Q392K possibly damaging Het
Nploc4 G T 11: 120,382,569 A576E probably benign Het
Nxph1 T A 6: 9,247,516 N162K probably damaging Het
Olfr1356 T A 10: 78,846,971 T315S probably benign Het
Olfr410 T C 11: 74,334,445 Y262C probably damaging Het
Pabpc2 T G 18: 39,775,116 I478S probably benign Het
Pde7b G T 10: 20,436,244 H190Q probably damaging Het
Plekha2 A T 8: 25,042,960 S332T probably benign Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl11a A T 5: 146,845,242 H9L probably benign Het
Rer1 A T 4: 155,075,001 F177I probably damaging Het
Rinl T C 7: 28,792,244 L74P probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rttn T C 18: 88,973,531 V78A probably benign Het
Skint5 A T 4: 113,846,311 probably null Het
Tenm2 A C 11: 36,008,103 Y2743D probably damaging Het
Tmem101 T C 11: 102,154,693 Y110C probably damaging Het
Trim9 T C 12: 70,248,374 N658S probably benign Het
Ucp1 A T 8: 83,290,688 T36S probably benign Het
Vmn2r43 A G 7: 8,255,068 I382T probably damaging Het
Zfp142 C T 1: 74,569,776 R1620Q probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Other mutations in Gatad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Gatad2b APN 3 90352078 missense possibly damaging 0.93
IGL02172:Gatad2b APN 3 90355671 splice site probably benign
IGL02672:Gatad2b APN 3 90341891 missense possibly damaging 0.77
IGL03030:Gatad2b APN 3 90341937 missense probably benign 0.11
FR4449:Gatad2b UTSW 3 90341917 small deletion probably benign
R0083:Gatad2b UTSW 3 90357943 missense probably damaging 1.00
R0108:Gatad2b UTSW 3 90357943 missense probably damaging 1.00
R0335:Gatad2b UTSW 3 90356182 missense probably benign 0.00
R0707:Gatad2b UTSW 3 90356182 missense probably benign 0.00
R1782:Gatad2b UTSW 3 90341871 missense probably benign 0.01
R2138:Gatad2b UTSW 3 90352113 missense probably damaging 1.00
R5954:Gatad2b UTSW 3 90351441 missense probably damaging 1.00
R6834:Gatad2b UTSW 3 90348643 missense probably benign 0.00
R7104:Gatad2b UTSW 3 90351417 missense probably damaging 1.00
R7190:Gatad2b UTSW 3 90350415 missense probably benign 0.01
R7291:Gatad2b UTSW 3 90351414 missense probably damaging 0.99
R7760:Gatad2b UTSW 3 90354469 missense probably damaging 1.00
R7786:Gatad2b UTSW 3 90355679 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCGTTAAGACGCTCAGGTCC -3'
(R):5'- TCCTGAAGAAGCATAGCCCCTAAGAG -3'

Sequencing Primer
(F):5'- gcacttgcttcccagatcc -3'
(R):5'- CCCCTAAGAGAAAGGAGGGTTATG -3'
Posted On2014-05-14