Mutagenetix > Incidental Mutation

Incidental Mutation 'R1722:Ucp1'

191554

Institutional Source

Beutler Lab

Gene Symbol

Ucp1

Ensembl Gene

ENSMUSG00000031710

Gene Name

uncoupling protein 1 (mitochondrial, proton carrier)

Synonyms

Slc25a7

MMRRC Submission

039754-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1722 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84016981-84025081 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84017317 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 36 (T36S)

Ref Sequence

ENSEMBL: ENSMUSP00000034146 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034146]

AlphaFold

P12242

Predicted Effect

probably benign
Transcript: ENSMUST00000034146
AA Change: T36S

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710
AA Change: T36S

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	10	107	5.7e-20	PFAM
Pfam:Mito_carr	109	206	3.3e-20	PFAM
Pfam:Mito_carr	209	300	1.6e-18	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931422A03Rik	A	T	2: 103,824,273 (GRCm39)		probably null	Het
Adss1	A	T	12: 112,602,915 (GRCm39)	I346F	possibly damaging	Het
Ahnak	T	A	19: 8,988,019 (GRCm39)	L3101H	probably damaging	Het
Aldh3b3	A	G	19: 4,014,871 (GRCm39)	I123V	possibly damaging	Het
Angptl1	C	T	1: 156,684,655 (GRCm39)	P275S	possibly damaging	Het
Apoa5	C	T	9: 46,181,847 (GRCm39)	Q308*	probably null	Het
Arhgef12	T	C	9: 42,932,013 (GRCm39)	*106W	probably null	Het
Atp2c1	A	G	9: 105,316,599 (GRCm39)	Y485H	probably benign	Het
Atp6v1b1	C	T	6: 83,720,074 (GRCm39)	T3I	possibly damaging	Het
Btbd7	A	T	12: 102,778,913 (GRCm39)	I451N	possibly damaging	Het
Clasp1	T	G	1: 118,518,194 (GRCm39)	L1080R	probably damaging	Het
Clec4f	A	G	6: 83,623,915 (GRCm39)	V408A	probably benign	Het
Clint1	T	A	11: 45,797,233 (GRCm39)	M438K	possibly damaging	Het
Cuzd1	A	T	7: 130,913,373 (GRCm39)	Y415N	probably damaging	Het
Ddias	A	G	7: 92,509,250 (GRCm39)	F222L	possibly damaging	Het
Efcab7	A	T	4: 99,757,815 (GRCm39)	T321S	probably benign	Het
Elp3	A	T	14: 65,788,846 (GRCm39)	D393E	probably benign	Het
Fbn2	T	C	18: 58,181,124 (GRCm39)		probably null	Het
Fcgr3	T	C	1: 170,881,688 (GRCm39)	R146G	possibly damaging	Het
Fkrp	G	A	7: 16,544,719 (GRCm39)	A381V	probably benign	Het
Gatad2b	T	G	3: 90,262,986 (GRCm39)	I476S	probably damaging	Het
Gm1527	C	T	3: 28,975,783 (GRCm39)	H557Y	probably benign	Het
Gm2431	A	T	7: 141,811,599 (GRCm39)	C102S	unknown	Het
Hoxd13	A	G	2: 74,500,389 (GRCm39)	N310S	probably benign	Het
Il9	T	A	13: 56,627,208 (GRCm39)	T135S	probably benign	Het
Ints4	A	C	7: 97,162,786 (GRCm39)	N476T	probably benign	Het
Kcnq4	A	C	4: 120,559,624 (GRCm39)	D525E	probably benign	Het
Kncn	A	T	4: 115,743,096 (GRCm39)	Y57F	probably damaging	Het
Lpl	TGG	TG	8: 69,349,254 (GRCm39)		probably null	Het
Lrrfip2	A	G	9: 111,028,829 (GRCm39)	T351A	probably damaging	Het
Madd	T	C	2: 90,997,982 (GRCm39)	E682G	probably benign	Het
Marchf7	A	C	2: 60,064,526 (GRCm39)	R267S	probably damaging	Het
Mmp16	T	A	4: 18,051,767 (GRCm39)	L252Q	probably damaging	Het
Mri1	A	T	8: 84,980,554 (GRCm39)	V296D	possibly damaging	Het
Myo3a	A	G	2: 22,404,638 (GRCm39)	T665A	probably benign	Het
N4bp2	T	C	5: 65,964,225 (GRCm39)	V758A	probably benign	Het
Nbea	T	C	3: 55,573,116 (GRCm39)	D2489G	probably damaging	Het
Neb	T	C	2: 52,146,757 (GRCm39)	T2836A	probably damaging	Het
Nedd4l	T	A	18: 65,291,010 (GRCm39)	V203E	probably damaging	Het
Nkpd1	C	A	7: 19,257,846 (GRCm39)	Q392K	possibly damaging	Het
Nploc4	G	T	11: 120,273,395 (GRCm39)	A576E	probably benign	Het
Nxph1	T	A	6: 9,247,516 (GRCm39)	N162K	probably damaging	Het
Or3a1	T	C	11: 74,225,271 (GRCm39)	Y262C	probably damaging	Het
Or7c70	T	A	10: 78,682,805 (GRCm39)	T315S	probably benign	Het
Pabpc2	T	G	18: 39,908,169 (GRCm39)	I478S	probably benign	Het
Pde7b	G	T	10: 20,311,990 (GRCm39)	H190Q	probably damaging	Het
Plekha2	A	T	8: 25,532,976 (GRCm39)	S332T	probably benign	Het
Rapgef6	TG	TGG	11: 54,437,223 (GRCm39)		probably null	Het
Rasl11a	A	T	5: 146,782,052 (GRCm39)	H9L	probably benign	Het
Rer1	A	T	4: 155,159,458 (GRCm39)	F177I	probably damaging	Het
Rinl	T	C	7: 28,491,669 (GRCm39)	L74P	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,229,115 (GRCm39)		probably benign	Het
Rttn	T	C	18: 88,991,655 (GRCm39)	V78A	probably benign	Het
Skint5	A	T	4: 113,703,508 (GRCm39)		probably null	Het
Tenm2	A	C	11: 35,898,930 (GRCm39)	Y2743D	probably damaging	Het
Tmem101	T	C	11: 102,045,519 (GRCm39)	Y110C	probably damaging	Het
Trim9	T	C	12: 70,295,148 (GRCm39)	N658S	probably benign	Het
Vmn2r43	A	G	7: 8,258,067 (GRCm39)	I382T	probably damaging	Het
Zfp142	C	T	1: 74,608,935 (GRCm39)	R1620Q	probably damaging	Het
Zfp386	T	C	12: 116,023,526 (GRCm39)	S380P	probably damaging	Het

Other mutations in Ucp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4585001:Ucp1	UTSW	8	84,020,577 (GRCm39)	missense	probably damaging	1.00
R0050:Ucp1	UTSW	8	84,020,857 (GRCm39)	missense	probably damaging	1.00
R0055:Ucp1	UTSW	8	84,017,233 (GRCm39)	nonsense	probably null
R0055:Ucp1	UTSW	8	84,017,233 (GRCm39)	nonsense	probably null
R0505:Ucp1	UTSW	8	84,021,936 (GRCm39)	missense	possibly damaging	0.78
R0590:Ucp1	UTSW	8	84,018,232 (GRCm39)	splice site	probably benign
R0681:Ucp1	UTSW	8	84,021,936 (GRCm39)	missense	possibly damaging	0.78
R0731:Ucp1	UTSW	8	84,024,476 (GRCm39)	splice site	probably benign
R1606:Ucp1	UTSW	8	84,021,933 (GRCm39)	missense	probably damaging	1.00
R1809:Ucp1	UTSW	8	84,024,496 (GRCm39)	missense	probably damaging	0.99
R1823:Ucp1	UTSW	8	84,020,661 (GRCm39)	missense	probably damaging	1.00
R3809:Ucp1	UTSW	8	84,017,270 (GRCm39)	missense	probably damaging	0.99
R4085:Ucp1	UTSW	8	84,020,580 (GRCm39)	missense	probably benign	0.43
R4673:Ucp1	UTSW	8	84,021,876 (GRCm39)	missense	probably damaging	1.00
R4998:Ucp1	UTSW	8	84,024,484 (GRCm39)	critical splice acceptor site	probably null
R5163:Ucp1	UTSW	8	84,020,832 (GRCm39)	missense	possibly damaging	0.95
R5421:Ucp1	UTSW	8	84,017,320 (GRCm39)	missense	probably benign	0.12
R5790:Ucp1	UTSW	8	84,024,520 (GRCm39)	missense	possibly damaging	0.54
R5994:Ucp1	UTSW	8	84,020,567 (GRCm39)	missense	possibly damaging	0.92
R6574:Ucp1	UTSW	8	84,020,718 (GRCm39)	critical splice donor site	probably null
R6732:Ucp1	UTSW	8	84,018,106 (GRCm39)	missense	probably benign	0.08
R7282:Ucp1	UTSW	8	84,020,531 (GRCm39)	missense	probably benign	0.03
R7343:Ucp1	UTSW	8	84,021,881 (GRCm39)	missense	probably damaging	0.99
R7878:Ucp1	UTSW	8	84,024,521 (GRCm39)	missense	probably benign	0.19
R8008:Ucp1	UTSW	8	84,020,640 (GRCm39)	missense	probably benign	0.32
R8365:Ucp1	UTSW	8	84,020,628 (GRCm39)	missense	probably damaging	0.97
R8899:Ucp1	UTSW	8	84,017,216 (GRCm39)	missense	probably benign	0.35
R9186:Ucp1	UTSW	8	84,017,272 (GRCm39)	nonsense	probably null
R9499:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00
R9551:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00
R9552:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAGGAAGGGACGCTCACCTTTG -3'
(R):5'- ACATGCTCAGGACACCATTGCC -3'

Sequencing Primer
(F):5'- TGCACTGGCACTACCTAGC -3'
(R):5'- GGCAGAGGCCATTTTTAACC -3'

Posted On

2014-05-14