Incidental Mutation 'R1722:Atp2c1'
ID191559
Institutional Source Beutler Lab
Gene Symbol Atp2c1
Ensembl Gene ENSMUSG00000032570
Gene NameATPase, Ca++-sequestering
SynonymsD930003G21Rik, SPCA, ATP2C1A, PMR1, 1700121J11Rik
MMRRC Submission 039754-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R1722 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location105403539-105527319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105439400 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 485 (Y485H)
Ref Sequence ENSEMBL: ENSMUSP00000082220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038118] [ENSMUST00000085133] [ENSMUST00000112558] [ENSMUST00000163879] [ENSMUST00000176770] [ENSMUST00000177074] [ENSMUST00000177293]
Predicted Effect probably benign
Transcript: ENSMUST00000038118
AA Change: Y451H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000039103
Gene: ENSMUSG00000032570
AA Change: Y451H

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 2.3e-75 PFAM
Pfam:Hydrolase 343 655 2.9e-31 PFAM
Pfam:HAD 346 652 7.7e-15 PFAM
Pfam:Hydrolase_like2 408 492 9.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 897 4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085133
AA Change: Y485H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000082220
Gene: ENSMUSG00000032570
AA Change: Y485H

DomainStartEndE-ValueType
Cation_ATPase_N 59 133 1.85e-14 SMART
Pfam:E1-E2_ATPase 138 372 3.4e-62 PFAM
Pfam:Hydrolase 377 689 2.6e-23 PFAM
Pfam:HAD 380 686 7.8e-14 PFAM
Pfam:Cation_ATPase 442 526 3.2e-19 PFAM
low complexity region 740 755 N/A INTRINSIC
Pfam:Cation_ATPase_C 759 931 3.8e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112557
Predicted Effect probably benign
Transcript: ENSMUST00000112558
AA Change: Y451H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000108177
Gene: ENSMUSG00000032570
AA Change: Y451H

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 2.3e-75 PFAM
Pfam:Hydrolase 343 655 2.9e-31 PFAM
Pfam:HAD 346 652 7.7e-15 PFAM
Pfam:Hydrolase_like2 408 492 9.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 897 4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163879
AA Change: Y435H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129617
Gene: ENSMUSG00000032570
AA Change: Y435H

DomainStartEndE-ValueType
Cation_ATPase_N 9 83 1.85e-14 SMART
Pfam:E1-E2_ATPase 89 323 5.2e-76 PFAM
Pfam:Hydrolase 327 639 5.6e-32 PFAM
Pfam:HAD 330 636 1.4e-15 PFAM
Pfam:Hydrolase_like2 392 476 3.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176770
AA Change: Y446H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134764
Gene: ENSMUSG00000032570
AA Change: Y446H

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 100 334 8.9e-76 PFAM
Pfam:Hydrolase 338 650 1.1e-31 PFAM
Pfam:HAD 341 647 2.7e-15 PFAM
Pfam:Hydrolase_like2 403 487 4.8e-20 PFAM
low complexity region 701 716 N/A INTRINSIC
Pfam:Cation_ATPase_C 720 892 1.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177000
Predicted Effect probably benign
Transcript: ENSMUST00000177074
AA Change: Y451H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000135646
Gene: ENSMUSG00000032570
AA Change: Y451H

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 8.2e-76 PFAM
Pfam:Hydrolase 343 655 1e-31 PFAM
Pfam:HAD 346 652 2.5e-15 PFAM
Pfam:Hydrolase_like2 408 492 4.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 886 7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177293
AA Change: Y315H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135802
Gene: ENSMUSG00000032570
AA Change: Y315H

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 1 203 6.7e-64 PFAM
Pfam:Hydrolase 207 519 7.4e-32 PFAM
Pfam:HAD 210 516 1.9e-15 PFAM
Pfam:Hydrolase_like2 272 356 3.8e-20 PFAM
transmembrane domain 564 586 N/A INTRINSIC
Pfam:Cation_ATPase_C 589 761 1.2e-47 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium ions. Defects in this gene cause Hailey-Hailey disease, an autosomal dominant disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth retardation, failure of rostral neural tube closure, Golgi and endoplasmic reticulum stress, increased apoptosis, accumulation of intracellular lipid droplets and midgestational lethality. Agedheterozygotes develop squamous cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A T 2: 103,993,928 probably null Het
Adssl1 A T 12: 112,636,481 I346F possibly damaging Het
Ahnak T A 19: 9,010,655 L3101H probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Angptl1 C T 1: 156,857,085 P275S possibly damaging Het
Apoa5 C T 9: 46,270,549 Q308* probably null Het
Arhgef12 T C 9: 43,020,717 *106W probably null Het
Atp6v1b1 C T 6: 83,743,092 T3I possibly damaging Het
Btbd7 A T 12: 102,812,654 I451N possibly damaging Het
Clasp1 T G 1: 118,590,464 L1080R probably damaging Het
Clec4f A G 6: 83,646,933 V408A probably benign Het
Clint1 T A 11: 45,906,406 M438K possibly damaging Het
Cuzd1 A T 7: 131,311,644 Y415N probably damaging Het
Ddias A G 7: 92,860,042 F222L possibly damaging Het
Efcab7 A T 4: 99,900,618 T321S probably benign Het
Elp3 A T 14: 65,551,397 D393E probably benign Het
Fbn2 T C 18: 58,048,052 probably null Het
Fcgr3 T C 1: 171,054,119 R146G possibly damaging Het
Fkrp G A 7: 16,810,794 A381V probably benign Het
Gatad2b T G 3: 90,355,679 I476S probably damaging Het
Gm1527 C T 3: 28,921,634 H557Y probably benign Het
Gm2431 A T 7: 142,257,862 C102S unknown Het
Hoxd13 A G 2: 74,670,045 N310S probably benign Het
Il9 T A 13: 56,479,395 T135S probably benign Het
Ints4 A C 7: 97,513,579 N476T probably benign Het
Kcnq4 A C 4: 120,702,427 D525E probably benign Het
Kncn A T 4: 115,885,899 Y57F probably damaging Het
Lpl TGG TG 8: 68,896,602 probably null Het
Lrrfip2 A G 9: 111,199,761 T351A probably damaging Het
Madd T C 2: 91,167,637 E682G probably benign Het
March7 A C 2: 60,234,182 R267S probably damaging Het
Mmp16 T A 4: 18,051,767 L252Q probably damaging Het
Mri1 A T 8: 84,253,925 V296D possibly damaging Het
Myo3a A G 2: 22,399,827 T665A probably benign Het
N4bp2 T C 5: 65,806,882 V758A probably benign Het
Nbea T C 3: 55,665,695 D2489G probably damaging Het
Neb T C 2: 52,256,745 T2836A probably damaging Het
Nedd4l T A 18: 65,157,939 V203E probably damaging Het
Nkpd1 C A 7: 19,523,921 Q392K possibly damaging Het
Nploc4 G T 11: 120,382,569 A576E probably benign Het
Nxph1 T A 6: 9,247,516 N162K probably damaging Het
Olfr1356 T A 10: 78,846,971 T315S probably benign Het
Olfr410 T C 11: 74,334,445 Y262C probably damaging Het
Pabpc2 T G 18: 39,775,116 I478S probably benign Het
Pde7b G T 10: 20,436,244 H190Q probably damaging Het
Plekha2 A T 8: 25,042,960 S332T probably benign Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl11a A T 5: 146,845,242 H9L probably benign Het
Rer1 A T 4: 155,075,001 F177I probably damaging Het
Rinl T C 7: 28,792,244 L74P probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rttn T C 18: 88,973,531 V78A probably benign Het
Skint5 A T 4: 113,846,311 probably null Het
Tenm2 A C 11: 36,008,103 Y2743D probably damaging Het
Tmem101 T C 11: 102,154,693 Y110C probably damaging Het
Trim9 T C 12: 70,248,374 N658S probably benign Het
Ucp1 A T 8: 83,290,688 T36S probably benign Het
Vmn2r43 A G 7: 8,255,068 I382T probably damaging Het
Zfp142 C T 1: 74,569,776 R1620Q probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Other mutations in Atp2c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Atp2c1 APN 9 105418579 missense probably damaging 1.00
IGL01682:Atp2c1 APN 9 105452842 missense probably damaging 1.00
IGL01874:Atp2c1 APN 9 105448825 missense probably damaging 1.00
IGL02299:Atp2c1 APN 9 105461087 unclassified probably benign
IGL03186:Atp2c1 APN 9 105413130 missense probably benign 0.10
IGL03212:Atp2c1 APN 9 105445267 missense probably damaging 1.00
IGL02799:Atp2c1 UTSW 9 105413043 unclassified probably benign
IGL03047:Atp2c1 UTSW 9 105521007 intron probably benign
R0885:Atp2c1 UTSW 9 105421573 critical splice donor site probably null
R1072:Atp2c1 UTSW 9 105459744 missense possibly damaging 0.92
R1469:Atp2c1 UTSW 9 105435152 nonsense probably null
R1469:Atp2c1 UTSW 9 105435152 nonsense probably null
R1611:Atp2c1 UTSW 9 105442852 missense probably damaging 0.98
R1638:Atp2c1 UTSW 9 105432698 missense probably damaging 0.96
R1667:Atp2c1 UTSW 9 105432797 missense probably null 0.94
R1734:Atp2c1 UTSW 9 105414655 missense probably damaging 1.00
R1782:Atp2c1 UTSW 9 105431587 missense probably damaging 0.99
R1964:Atp2c1 UTSW 9 105446123 missense probably damaging 1.00
R2008:Atp2c1 UTSW 9 105432726 missense probably benign 0.00
R2093:Atp2c1 UTSW 9 105418121 nonsense probably null
R3720:Atp2c1 UTSW 9 105422976 missense probably damaging 1.00
R4118:Atp2c1 UTSW 9 105466659 missense probably damaging 1.00
R4273:Atp2c1 UTSW 9 105435140 missense probably benign 0.10
R4763:Atp2c1 UTSW 9 105418567 missense probably damaging 1.00
R4962:Atp2c1 UTSW 9 105442950 missense probably benign 0.03
R5121:Atp2c1 UTSW 9 105448825 missense probably damaging 1.00
R5458:Atp2c1 UTSW 9 105414725 nonsense probably null
R5551:Atp2c1 UTSW 9 105459737 missense probably damaging 1.00
R6198:Atp2c1 UTSW 9 105521072 missense probably benign 0.00
R6414:Atp2c1 UTSW 9 105466656 missense probably damaging 1.00
R6432:Atp2c1 UTSW 9 105445313 missense probably damaging 1.00
R6675:Atp2c1 UTSW 9 105453533 critical splice donor site probably null
R6719:Atp2c1 UTSW 9 105424178 missense probably damaging 1.00
R6777:Atp2c1 UTSW 9 105418600 missense possibly damaging 0.64
R6847:Atp2c1 UTSW 9 105418579 missense probably damaging 1.00
R6870:Atp2c1 UTSW 9 105470062 missense probably benign 0.13
R7097:Atp2c1 UTSW 9 105464651 missense probably damaging 1.00
R7120:Atp2c1 UTSW 9 105420186 nonsense probably null
R7216:Atp2c1 UTSW 9 105467731 missense probably benign 0.00
R7284:Atp2c1 UTSW 9 105520809 intron probably null
R7365:Atp2c1 UTSW 9 105422999 missense probably damaging 1.00
R7448:Atp2c1 UTSW 9 105452783 missense probably damaging 0.98
R7818:Atp2c1 UTSW 9 105414757 missense probably benign 0.06
X0053:Atp2c1 UTSW 9 105418684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAGCCTAGCCTGGAATGC -3'
(R):5'- TCTGTGTAGTGAGGCTTTCATGTTCAAA -3'

Sequencing Primer
(F):5'- agcctggaatgcacacc -3'
(R):5'- gtaagccaggggaagcaag -3'
Posted On2014-05-14