Incidental Mutation 'R1722:Nedd4l'
ID 191582
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 039754-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R1722 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65291010 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 203 (V203E)
Ref Sequence ENSEMBL: ENSMUSP00000132838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000224385] [ENSMUST00000225057] [ENSMUST00000225261] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080418
AA Change: V82E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: V82E

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163516
AA Change: V203E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: V203E

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224347
AA Change: V82E

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000224385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224890
Predicted Effect probably benign
Transcript: ENSMUST00000225057
Predicted Effect probably damaging
Transcript: ENSMUST00000225261
AA Change: V82E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000226058
AA Change: V82E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A T 2: 103,824,273 (GRCm39) probably null Het
Adss1 A T 12: 112,602,915 (GRCm39) I346F possibly damaging Het
Ahnak T A 19: 8,988,019 (GRCm39) L3101H probably damaging Het
Aldh3b3 A G 19: 4,014,871 (GRCm39) I123V possibly damaging Het
Angptl1 C T 1: 156,684,655 (GRCm39) P275S possibly damaging Het
Apoa5 C T 9: 46,181,847 (GRCm39) Q308* probably null Het
Arhgef12 T C 9: 42,932,013 (GRCm39) *106W probably null Het
Atp2c1 A G 9: 105,316,599 (GRCm39) Y485H probably benign Het
Atp6v1b1 C T 6: 83,720,074 (GRCm39) T3I possibly damaging Het
Btbd7 A T 12: 102,778,913 (GRCm39) I451N possibly damaging Het
Clasp1 T G 1: 118,518,194 (GRCm39) L1080R probably damaging Het
Clec4f A G 6: 83,623,915 (GRCm39) V408A probably benign Het
Clint1 T A 11: 45,797,233 (GRCm39) M438K possibly damaging Het
Cuzd1 A T 7: 130,913,373 (GRCm39) Y415N probably damaging Het
Ddias A G 7: 92,509,250 (GRCm39) F222L possibly damaging Het
Efcab7 A T 4: 99,757,815 (GRCm39) T321S probably benign Het
Elp3 A T 14: 65,788,846 (GRCm39) D393E probably benign Het
Fbn2 T C 18: 58,181,124 (GRCm39) probably null Het
Fcgr3 T C 1: 170,881,688 (GRCm39) R146G possibly damaging Het
Fkrp G A 7: 16,544,719 (GRCm39) A381V probably benign Het
Gatad2b T G 3: 90,262,986 (GRCm39) I476S probably damaging Het
Gm1527 C T 3: 28,975,783 (GRCm39) H557Y probably benign Het
Gm2431 A T 7: 141,811,599 (GRCm39) C102S unknown Het
Hoxd13 A G 2: 74,500,389 (GRCm39) N310S probably benign Het
Il9 T A 13: 56,627,208 (GRCm39) T135S probably benign Het
Ints4 A C 7: 97,162,786 (GRCm39) N476T probably benign Het
Kcnq4 A C 4: 120,559,624 (GRCm39) D525E probably benign Het
Kncn A T 4: 115,743,096 (GRCm39) Y57F probably damaging Het
Lpl TGG TG 8: 69,349,254 (GRCm39) probably null Het
Lrrfip2 A G 9: 111,028,829 (GRCm39) T351A probably damaging Het
Madd T C 2: 90,997,982 (GRCm39) E682G probably benign Het
Marchf7 A C 2: 60,064,526 (GRCm39) R267S probably damaging Het
Mmp16 T A 4: 18,051,767 (GRCm39) L252Q probably damaging Het
Mri1 A T 8: 84,980,554 (GRCm39) V296D possibly damaging Het
Myo3a A G 2: 22,404,638 (GRCm39) T665A probably benign Het
N4bp2 T C 5: 65,964,225 (GRCm39) V758A probably benign Het
Nbea T C 3: 55,573,116 (GRCm39) D2489G probably damaging Het
Neb T C 2: 52,146,757 (GRCm39) T2836A probably damaging Het
Nkpd1 C A 7: 19,257,846 (GRCm39) Q392K possibly damaging Het
Nploc4 G T 11: 120,273,395 (GRCm39) A576E probably benign Het
Nxph1 T A 6: 9,247,516 (GRCm39) N162K probably damaging Het
Or3a1 T C 11: 74,225,271 (GRCm39) Y262C probably damaging Het
Or7c70 T A 10: 78,682,805 (GRCm39) T315S probably benign Het
Pabpc2 T G 18: 39,908,169 (GRCm39) I478S probably benign Het
Pde7b G T 10: 20,311,990 (GRCm39) H190Q probably damaging Het
Plekha2 A T 8: 25,532,976 (GRCm39) S332T probably benign Het
Rapgef6 TG TGG 11: 54,437,223 (GRCm39) probably null Het
Rasl11a A T 5: 146,782,052 (GRCm39) H9L probably benign Het
Rer1 A T 4: 155,159,458 (GRCm39) F177I probably damaging Het
Rinl T C 7: 28,491,669 (GRCm39) L74P probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Rttn T C 18: 88,991,655 (GRCm39) V78A probably benign Het
Skint5 A T 4: 113,703,508 (GRCm39) probably null Het
Tenm2 A C 11: 35,898,930 (GRCm39) Y2743D probably damaging Het
Tmem101 T C 11: 102,045,519 (GRCm39) Y110C probably damaging Het
Trim9 T C 12: 70,295,148 (GRCm39) N658S probably benign Het
Ucp1 A T 8: 84,017,317 (GRCm39) T36S probably benign Het
Vmn2r43 A G 7: 8,258,067 (GRCm39) I382T probably damaging Het
Zfp142 C T 1: 74,608,935 (GRCm39) R1620Q probably damaging Het
Zfp386 T C 12: 116,023,526 (GRCm39) S380P probably damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0396:Nedd4l UTSW 18 65,294,725 (GRCm39) splice site probably benign
R0472:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65,306,092 (GRCm39) missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65,341,574 (GRCm39) splice site probably benign
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65,213,131 (GRCm39) nonsense probably null
R5106:Nedd4l UTSW 18 65,326,376 (GRCm39) missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65,307,315 (GRCm39) critical splice donor site probably null
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8440:Nedd4l UTSW 18 65,022,126 (GRCm39) splice site probably null
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9025:Nedd4l UTSW 18 65,311,995 (GRCm39) missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9482:Nedd4l UTSW 18 65,021,031 (GRCm39) unclassified probably benign
R9498:Nedd4l UTSW 18 65,294,723 (GRCm39) critical splice donor site probably null
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTGCTTGTCAGCACACATACTC -3'
(R):5'- CCAAACTTGTCCTGGAACTGCCAC -3'

Sequencing Primer
(F):5'- tggagaggaactctagctcag -3'
(R):5'- TGGAACTGCCACCCATTG -3'
Posted On 2014-05-14