Mutagenetix > Incidental Mutations

Incidental Mutation 'R1723:Zbtb41'

191590

Institutional Source

Beutler Lab

Gene Symbol

Zbtb41

Ensembl Gene

ENSMUSG00000033964

Gene Name

zinc finger and BTB domain containing 41

Synonyms

9830132G07Rik, 8430415N23Rik

MMRRC Submission

039755-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.209) question?

Stock #

R1723 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139422288-139453005 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 139423563 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 138 (Q138L)

Ref Sequence

ENSEMBL: ENSMUSP00000045570 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039867] [ENSMUST00000200243]

Predicted Effect

probably benign
Transcript: ENSMUST00000039867
AA Change: Q138L

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000045570
Gene: ENSMUSG00000033964
AA Change: Q138L

Domain	Start	End	E-Value	Type
low complexity region	70	81	N/A	INTRINSIC
BTB	89	183	7.06e-16	SMART
ZnF_C2H2	208	231	3.78e-1	SMART
low complexity region	234	245	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	301	327	N/A	INTRINSIC
ZnF_C2H2	360	382	4.17e-3	SMART
ZnF_C2H2	388	410	8.34e-3	SMART
ZnF_C2H2	421	444	2.67e-1	SMART
ZnF_C2H2	462	484	1.72e-4	SMART
ZnF_C2H2	490	513	1.41e0	SMART
ZnF_C2H2	517	540	1.12e-3	SMART
ZnF_C2H2	546	568	1.36e-2	SMART
ZnF_C2H2	574	596	2.91e-2	SMART
ZnF_C2H2	602	624	7.37e-4	SMART
ZnF_C2H2	630	653	3.39e-3	SMART
ZnF_C2H2	667	689	2.75e-3	SMART
ZnF_C2H2	695	717	3.16e-3	SMART
ZnF_C2H2	723	746	3.34e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199011

Predicted Effect

probably benign
Transcript: ENSMUST00000200243
AA Change: Q138L

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000142797
Gene: ENSMUSG00000033964
AA Change: Q138L

Domain	Start	End	E-Value	Type
low complexity region	70	81	N/A	INTRINSIC
BTB	89	183	4.7e-18	SMART
ZnF_C2H2	208	231	1.6e-3	SMART
low complexity region	234	245	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	301	327	N/A	INTRINSIC
ZnF_C2H2	360	382	1.7e-5	SMART
ZnF_C2H2	388	410	3.5e-5	SMART
ZnF_C2H2	421	444	1.1e-3	SMART
ZnF_C2H2	462	484	7.2e-7	SMART
ZnF_C2H2	490	513	5.9e-3	SMART
ZnF_C2H2	517	540	4.7e-6	SMART
ZnF_C2H2	546	568	5.7e-5	SMART
ZnF_C2H2	574	596	1.3e-4	SMART
ZnF_C2H2	602	624	3e-6	SMART
ZnF_C2H2	630	653	1.5e-5	SMART

Meta Mutation Damage Score

0.1344

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alms1	G	T	6: 85,628,753	G2462C	probably damaging	Het
Anapc5	T	C	5: 122,799,343	E464G	probably damaging	Het
Aoc3	T	A	11: 101,336,435	V378E	possibly damaging	Het
Atp13a5	T	A	16: 29,232,799	K1152I	possibly damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
BC027072	A	T	17: 71,750,378	F768Y	probably damaging	Het
Calcoco1	C	A	15: 102,719,553	G49C	probably damaging	Het
Cbwd1	A	G	19: 24,948,094	V166A	possibly damaging	Het
Cd70	T	C	17: 57,146,401	T88A	possibly damaging	Het
Cpeb1	C	T	7: 81,436,226	R56Q	probably benign	Het
Dglucy	A	G	12: 100,842,679	Y212C	probably damaging	Het
Dnhd1	C	A	7: 105,714,920	P4160T	possibly damaging	Het
Ecel1	T	C	1: 87,154,421	D190G	probably benign	Het
Exoc6b	A	G	6: 85,069,344	L21P	probably damaging	Het
Fam110c	A	G	12: 31,074,395	R119G	unknown	Het
Fam198b	T	A	3: 79,936,663	N32K	probably benign	Het
Gm42791	C	A	5: 148,959,501		probably benign	Het
Hpcal4	A	G	4: 123,190,739	I154V	probably benign	Het
Itgb1	A	G	8: 128,726,038	D728G	probably damaging	Het
Kdm5d	A	T	Y: 927,753	D701V	probably damaging	Het
Kif18a	A	G	2: 109,302,882	K448E	probably damaging	Het
Kif26a	T	C	12: 112,173,858	F507S	possibly damaging	Het
Kmt2c	C	T	5: 25,315,005	G2036R	probably damaging	Het
Lrrc43	T	A	5: 123,492,213		probably benign	Het
Map3k20	T	C	2: 72,389,492	I256T	probably damaging	Het
Med29	T	A	7: 28,392,705		probably benign	Het
Mob3b	A	G	4: 34,954,026	C215R	probably damaging	Het
Mtf2	T	C	5: 108,088,070	Y87H	probably damaging	Het
Myo18a	G	A	11: 77,853,314	R1834K	probably damaging	Het
Nlrc4	T	A	17: 74,441,908	D779V	probably damaging	Het
Olfr638	T	C	7: 104,003,311	F18S	probably damaging	Het
Otud3	T	C	4: 138,898,018	T242A	probably damaging	Het
Pnliprp1	T	A	19: 58,732,142	M150K	possibly damaging	Het
Polm	T	A	11: 5,834,776	Q227L	probably benign	Het
Poln	A	G	5: 34,122,672	V282A	probably benign	Het
Ppfia2	T	A	10: 106,915,672		probably null	Het
Rad51	T	G	2: 119,123,814	M168R	probably benign	Het
Senp2	A	G	16: 22,028,042	T266A	probably benign	Het
Sfswap	A	G	5: 129,539,694	T401A	probably benign	Het
Slc35a4	C	A	18: 36,682,735	T206K	possibly damaging	Het
Slc40a1	A	G	1: 45,924,761	S23P	probably damaging	Het
Spef2	T	C	15: 9,614,209	K1217R	probably damaging	Het
St18	A	C	1: 6,810,685		probably benign	Het
Tdrd6	T	C	17: 43,628,327	D610G	possibly damaging	Het
Tmem163	C	A	1: 127,551,371	R137L	probably damaging	Het
Tmem94	T	A	11: 115,794,748	D942E	probably damaging	Het
Ttn	T	A	2: 76,750,410	I23380F	possibly damaging	Het
Uckl1	T	A	2: 181,570,600		probably null	Het
Vav2	T	C	2: 27,318,964	D99G	possibly damaging	Het
Vmn2r30	T	A	7: 7,334,260	I126F	probably benign	Het
Zfp599	T	C	9: 22,258,065	Y37C	probably damaging	Het
Zfp784	T	A	7: 5,035,783	T259S	possibly damaging	Het
Zfp954	T	C	7: 7,115,838	S236G	probably benign	Het

Other mutations in Zbtb41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Zbtb41	APN	1	139430324	missense	probably benign	0.01
IGL01796:Zbtb41	APN	1	139442883	missense	probably damaging	0.99
IGL01844:Zbtb41	APN	1	139447327	missense	probably benign	0.01
IGL02150:Zbtb41	APN	1	139440448	missense	possibly damaging	0.73
IGL02346:Zbtb41	APN	1	139447100	missense	probably damaging	1.00
IGL03139:Zbtb41	APN	1	139423838	missense	probably benign	0.00
IGL03215:Zbtb41	APN	1	139446950	missense	probably damaging	1.00
IGL03309:Zbtb41	APN	1	139432078	critical splice donor site	probably null
memorialized	UTSW	1	139440394	missense	probably benign	0.00
Noted	UTSW	1	139439031	missense	probably damaging	0.99
unforgotten	UTSW	1	139432078	critical splice donor site	probably null
R0004:Zbtb41	UTSW	1	139442888	missense	possibly damaging	0.90
R0010:Zbtb41	UTSW	1	139423530	missense	probably damaging	1.00
R0010:Zbtb41	UTSW	1	139423530	missense	probably damaging	1.00
R0048:Zbtb41	UTSW	1	139441834	missense	probably damaging	1.00
R0230:Zbtb41	UTSW	1	139446935	missense	probably damaging	1.00
R0309:Zbtb41	UTSW	1	139438984	missense	probably damaging	0.99
R0458:Zbtb41	UTSW	1	139423476	missense	probably damaging	1.00
R0606:Zbtb41	UTSW	1	139423610	missense	probably benign	0.28
R0964:Zbtb41	UTSW	1	139439031	missense	probably damaging	0.99
R1531:Zbtb41	UTSW	1	139423193	missense	probably benign	0.00
R1765:Zbtb41	UTSW	1	139440394	missense	probably benign	0.00
R1829:Zbtb41	UTSW	1	139446922	nonsense	probably null
R2077:Zbtb41	UTSW	1	139424093	missense	probably damaging	1.00
R2292:Zbtb41	UTSW	1	139440359	missense	probably damaging	0.99
R2380:Zbtb41	UTSW	1	139423814	missense	probably damaging	0.99
R2402:Zbtb41	UTSW	1	139423185	missense	probably benign	0.10
R2402:Zbtb41	UTSW	1	139423187	nonsense	probably null
R3847:Zbtb41	UTSW	1	139423996	missense	probably benign
R3848:Zbtb41	UTSW	1	139423996	missense	probably benign
R3849:Zbtb41	UTSW	1	139423996	missense	probably benign
R4077:Zbtb41	UTSW	1	139429326	missense	probably benign	0.11
R4641:Zbtb41	UTSW	1	139442819	missense	probably damaging	0.98
R4772:Zbtb41	UTSW	1	139447414	missense	probably damaging	1.00
R5646:Zbtb41	UTSW	1	139423763	missense	probably benign	0.05
R5754:Zbtb41	UTSW	1	139432078	critical splice donor site	probably null
R6002:Zbtb41	UTSW	1	139423659	missense	probably damaging	1.00
R6045:Zbtb41	UTSW	1	139424032	missense	probably benign	0.34
R6302:Zbtb41	UTSW	1	139429289	missense	possibly damaging	0.67
R6318:Zbtb41	UTSW	1	139430306	missense	possibly damaging	0.91
R6430:Zbtb41	UTSW	1	139447207	missense	probably benign	0.02
R6906:Zbtb41	UTSW	1	139423390	missense	possibly damaging	0.59
R7584:Zbtb41	UTSW	1	139424057	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TGATAGGCAGAAGCAACCGTCTTTC -3'
(R):5'- ACTTGACAGGGCACTTCCGATTC -3'

Sequencing Primer
(F):5'- CTGCGATTTACTTATCATAGTGGAAG -3'
(R):5'- TTGCACTGATGACTACTCGACAG -3'

Posted On

2014-05-14