Incidental Mutation 'R1723:Zbtb41'
ID191590
Institutional Source Beutler Lab
Gene Symbol Zbtb41
Ensembl Gene ENSMUSG00000033964
Gene Namezinc finger and BTB domain containing 41
Synonyms9830132G07Rik, 8430415N23Rik
MMRRC Submission 039755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R1723 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location139422288-139453005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139423563 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 138 (Q138L)
Ref Sequence ENSEMBL: ENSMUSP00000045570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039867] [ENSMUST00000200243]
Predicted Effect probably benign
Transcript: ENSMUST00000039867
AA Change: Q138L

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045570
Gene: ENSMUSG00000033964
AA Change: Q138L

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
BTB 89 183 7.06e-16 SMART
ZnF_C2H2 208 231 3.78e-1 SMART
low complexity region 234 245 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 301 327 N/A INTRINSIC
ZnF_C2H2 360 382 4.17e-3 SMART
ZnF_C2H2 388 410 8.34e-3 SMART
ZnF_C2H2 421 444 2.67e-1 SMART
ZnF_C2H2 462 484 1.72e-4 SMART
ZnF_C2H2 490 513 1.41e0 SMART
ZnF_C2H2 517 540 1.12e-3 SMART
ZnF_C2H2 546 568 1.36e-2 SMART
ZnF_C2H2 574 596 2.91e-2 SMART
ZnF_C2H2 602 624 7.37e-4 SMART
ZnF_C2H2 630 653 3.39e-3 SMART
ZnF_C2H2 667 689 2.75e-3 SMART
ZnF_C2H2 695 717 3.16e-3 SMART
ZnF_C2H2 723 746 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199011
Predicted Effect probably benign
Transcript: ENSMUST00000200243
AA Change: Q138L

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142797
Gene: ENSMUSG00000033964
AA Change: Q138L

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
BTB 89 183 4.7e-18 SMART
ZnF_C2H2 208 231 1.6e-3 SMART
low complexity region 234 245 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 301 327 N/A INTRINSIC
ZnF_C2H2 360 382 1.7e-5 SMART
ZnF_C2H2 388 410 3.5e-5 SMART
ZnF_C2H2 421 444 1.1e-3 SMART
ZnF_C2H2 462 484 7.2e-7 SMART
ZnF_C2H2 490 513 5.9e-3 SMART
ZnF_C2H2 517 540 4.7e-6 SMART
ZnF_C2H2 546 568 5.7e-5 SMART
ZnF_C2H2 574 596 1.3e-4 SMART
ZnF_C2H2 602 624 3e-6 SMART
ZnF_C2H2 630 653 1.5e-5 SMART
Meta Mutation Damage Score 0.1344 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 G T 6: 85,628,753 G2462C probably damaging Het
Anapc5 T C 5: 122,799,343 E464G probably damaging Het
Aoc3 T A 11: 101,336,435 V378E possibly damaging Het
Atp13a5 T A 16: 29,232,799 K1152I possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC027072 A T 17: 71,750,378 F768Y probably damaging Het
Calcoco1 C A 15: 102,719,553 G49C probably damaging Het
Cbwd1 A G 19: 24,948,094 V166A possibly damaging Het
Cd70 T C 17: 57,146,401 T88A possibly damaging Het
Cpeb1 C T 7: 81,436,226 R56Q probably benign Het
Dglucy A G 12: 100,842,679 Y212C probably damaging Het
Dnhd1 C A 7: 105,714,920 P4160T possibly damaging Het
Ecel1 T C 1: 87,154,421 D190G probably benign Het
Exoc6b A G 6: 85,069,344 L21P probably damaging Het
Fam110c A G 12: 31,074,395 R119G unknown Het
Fam198b T A 3: 79,936,663 N32K probably benign Het
Gm42791 C A 5: 148,959,501 probably benign Het
Hpcal4 A G 4: 123,190,739 I154V probably benign Het
Itgb1 A G 8: 128,726,038 D728G probably damaging Het
Kdm5d A T Y: 927,753 D701V probably damaging Het
Kif18a A G 2: 109,302,882 K448E probably damaging Het
Kif26a T C 12: 112,173,858 F507S possibly damaging Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lrrc43 T A 5: 123,492,213 probably benign Het
Map3k20 T C 2: 72,389,492 I256T probably damaging Het
Med29 T A 7: 28,392,705 probably benign Het
Mob3b A G 4: 34,954,026 C215R probably damaging Het
Mtf2 T C 5: 108,088,070 Y87H probably damaging Het
Myo18a G A 11: 77,853,314 R1834K probably damaging Het
Nlrc4 T A 17: 74,441,908 D779V probably damaging Het
Olfr638 T C 7: 104,003,311 F18S probably damaging Het
Otud3 T C 4: 138,898,018 T242A probably damaging Het
Pnliprp1 T A 19: 58,732,142 M150K possibly damaging Het
Polm T A 11: 5,834,776 Q227L probably benign Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppfia2 T A 10: 106,915,672 probably null Het
Rad51 T G 2: 119,123,814 M168R probably benign Het
Senp2 A G 16: 22,028,042 T266A probably benign Het
Sfswap A G 5: 129,539,694 T401A probably benign Het
Slc35a4 C A 18: 36,682,735 T206K possibly damaging Het
Slc40a1 A G 1: 45,924,761 S23P probably damaging Het
Spef2 T C 15: 9,614,209 K1217R probably damaging Het
St18 A C 1: 6,810,685 probably benign Het
Tdrd6 T C 17: 43,628,327 D610G possibly damaging Het
Tmem163 C A 1: 127,551,371 R137L probably damaging Het
Tmem94 T A 11: 115,794,748 D942E probably damaging Het
Ttn T A 2: 76,750,410 I23380F possibly damaging Het
Uckl1 T A 2: 181,570,600 probably null Het
Vav2 T C 2: 27,318,964 D99G possibly damaging Het
Vmn2r30 T A 7: 7,334,260 I126F probably benign Het
Zfp599 T C 9: 22,258,065 Y37C probably damaging Het
Zfp784 T A 7: 5,035,783 T259S possibly damaging Het
Zfp954 T C 7: 7,115,838 S236G probably benign Het
Other mutations in Zbtb41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Zbtb41 APN 1 139430324 missense probably benign 0.01
IGL01796:Zbtb41 APN 1 139442883 missense probably damaging 0.99
IGL01844:Zbtb41 APN 1 139447327 missense probably benign 0.01
IGL02150:Zbtb41 APN 1 139440448 missense possibly damaging 0.73
IGL02346:Zbtb41 APN 1 139447100 missense probably damaging 1.00
IGL03139:Zbtb41 APN 1 139423838 missense probably benign 0.00
IGL03215:Zbtb41 APN 1 139446950 missense probably damaging 1.00
IGL03309:Zbtb41 APN 1 139432078 critical splice donor site probably null
memorialized UTSW 1 139440394 missense probably benign 0.00
Noted UTSW 1 139439031 missense probably damaging 0.99
unforgotten UTSW 1 139432078 critical splice donor site probably null
R0004:Zbtb41 UTSW 1 139442888 missense possibly damaging 0.90
R0010:Zbtb41 UTSW 1 139423530 missense probably damaging 1.00
R0010:Zbtb41 UTSW 1 139423530 missense probably damaging 1.00
R0048:Zbtb41 UTSW 1 139441834 missense probably damaging 1.00
R0230:Zbtb41 UTSW 1 139446935 missense probably damaging 1.00
R0309:Zbtb41 UTSW 1 139438984 missense probably damaging 0.99
R0458:Zbtb41 UTSW 1 139423476 missense probably damaging 1.00
R0606:Zbtb41 UTSW 1 139423610 missense probably benign 0.28
R0964:Zbtb41 UTSW 1 139439031 missense probably damaging 0.99
R1531:Zbtb41 UTSW 1 139423193 missense probably benign 0.00
R1765:Zbtb41 UTSW 1 139440394 missense probably benign 0.00
R1829:Zbtb41 UTSW 1 139446922 nonsense probably null
R2077:Zbtb41 UTSW 1 139424093 missense probably damaging 1.00
R2292:Zbtb41 UTSW 1 139440359 missense probably damaging 0.99
R2380:Zbtb41 UTSW 1 139423814 missense probably damaging 0.99
R2402:Zbtb41 UTSW 1 139423185 missense probably benign 0.10
R2402:Zbtb41 UTSW 1 139423187 nonsense probably null
R3847:Zbtb41 UTSW 1 139423996 missense probably benign
R3848:Zbtb41 UTSW 1 139423996 missense probably benign
R3849:Zbtb41 UTSW 1 139423996 missense probably benign
R4077:Zbtb41 UTSW 1 139429326 missense probably benign 0.11
R4641:Zbtb41 UTSW 1 139442819 missense probably damaging 0.98
R4772:Zbtb41 UTSW 1 139447414 missense probably damaging 1.00
R5646:Zbtb41 UTSW 1 139423763 missense probably benign 0.05
R5754:Zbtb41 UTSW 1 139432078 critical splice donor site probably null
R6002:Zbtb41 UTSW 1 139423659 missense probably damaging 1.00
R6045:Zbtb41 UTSW 1 139424032 missense probably benign 0.34
R6302:Zbtb41 UTSW 1 139429289 missense possibly damaging 0.67
R6318:Zbtb41 UTSW 1 139430306 missense possibly damaging 0.91
R6430:Zbtb41 UTSW 1 139447207 missense probably benign 0.02
R6906:Zbtb41 UTSW 1 139423390 missense possibly damaging 0.59
R7584:Zbtb41 UTSW 1 139424057 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGATAGGCAGAAGCAACCGTCTTTC -3'
(R):5'- ACTTGACAGGGCACTTCCGATTC -3'

Sequencing Primer
(F):5'- CTGCGATTTACTTATCATAGTGGAAG -3'
(R):5'- TTGCACTGATGACTACTCGACAG -3'
Posted On2014-05-14