Incidental Mutation 'R1723:Otud3'
ID191601
Institutional Source Beutler Lab
Gene Symbol Otud3
Ensembl Gene ENSMUSG00000041161
Gene NameOTU domain containing 3
Synonyms
MMRRC Submission 039755-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1723 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location138895379-138913945 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138898018 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 242 (T242A)
Ref Sequence ENSEMBL: ENSMUSP00000095441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097830]
Predicted Effect probably damaging
Transcript: ENSMUST00000097830
AA Change: T242A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095441
Gene: ENSMUSG00000041161
AA Change: T242A

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
Pfam:OTU 70 185 3.6e-12 PFAM
coiled coil region 340 370 N/A INTRINSIC
Meta Mutation Damage Score 0.1261 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 G T 6: 85,628,753 G2462C probably damaging Het
Anapc5 T C 5: 122,799,343 E464G probably damaging Het
Aoc3 T A 11: 101,336,435 V378E possibly damaging Het
Atp13a5 T A 16: 29,232,799 K1152I possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC027072 A T 17: 71,750,378 F768Y probably damaging Het
Calcoco1 C A 15: 102,719,553 G49C probably damaging Het
Cbwd1 A G 19: 24,948,094 V166A possibly damaging Het
Cd70 T C 17: 57,146,401 T88A possibly damaging Het
Cpeb1 C T 7: 81,436,226 R56Q probably benign Het
Dglucy A G 12: 100,842,679 Y212C probably damaging Het
Dnhd1 C A 7: 105,714,920 P4160T possibly damaging Het
Ecel1 T C 1: 87,154,421 D190G probably benign Het
Exoc6b A G 6: 85,069,344 L21P probably damaging Het
Fam110c A G 12: 31,074,395 R119G unknown Het
Fam198b T A 3: 79,936,663 N32K probably benign Het
Gm42791 C A 5: 148,959,501 probably benign Het
Hpcal4 A G 4: 123,190,739 I154V probably benign Het
Itgb1 A G 8: 128,726,038 D728G probably damaging Het
Kdm5d A T Y: 927,753 D701V probably damaging Het
Kif18a A G 2: 109,302,882 K448E probably damaging Het
Kif26a T C 12: 112,173,858 F507S possibly damaging Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lrrc43 T A 5: 123,492,213 probably benign Het
Map3k20 T C 2: 72,389,492 I256T probably damaging Het
Med29 T A 7: 28,392,705 probably benign Het
Mob3b A G 4: 34,954,026 C215R probably damaging Het
Mtf2 T C 5: 108,088,070 Y87H probably damaging Het
Myo18a G A 11: 77,853,314 R1834K probably damaging Het
Nlrc4 T A 17: 74,441,908 D779V probably damaging Het
Olfr638 T C 7: 104,003,311 F18S probably damaging Het
Pnliprp1 T A 19: 58,732,142 M150K possibly damaging Het
Polm T A 11: 5,834,776 Q227L probably benign Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppfia2 T A 10: 106,915,672 probably null Het
Rad51 T G 2: 119,123,814 M168R probably benign Het
Senp2 A G 16: 22,028,042 T266A probably benign Het
Sfswap A G 5: 129,539,694 T401A probably benign Het
Slc35a4 C A 18: 36,682,735 T206K possibly damaging Het
Slc40a1 A G 1: 45,924,761 S23P probably damaging Het
Spef2 T C 15: 9,614,209 K1217R probably damaging Het
St18 A C 1: 6,810,685 probably benign Het
Tdrd6 T C 17: 43,628,327 D610G possibly damaging Het
Tmem163 C A 1: 127,551,371 R137L probably damaging Het
Tmem94 T A 11: 115,794,748 D942E probably damaging Het
Ttn T A 2: 76,750,410 I23380F possibly damaging Het
Uckl1 T A 2: 181,570,600 probably null Het
Vav2 T C 2: 27,318,964 D99G possibly damaging Het
Vmn2r30 T A 7: 7,334,260 I126F probably benign Het
Zbtb41 A T 1: 139,423,563 Q138L probably benign Het
Zfp599 T C 9: 22,258,065 Y37C probably damaging Het
Zfp784 T A 7: 5,035,783 T259S possibly damaging Het
Zfp954 T C 7: 7,115,838 S236G probably benign Het
Other mutations in Otud3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Otud3 APN 4 138896897 missense probably benign
IGL01786:Otud3 APN 4 138896897 missense probably benign
IGL02125:Otud3 APN 4 138896714 critical splice donor site probably null
IGL03256:Otud3 APN 4 138909617 missense probably damaging 1.00
R0647:Otud3 UTSW 4 138913637 missense probably damaging 1.00
R1744:Otud3 UTSW 4 138895748 missense probably damaging 1.00
R1760:Otud3 UTSW 4 138895781 missense possibly damaging 0.51
R1954:Otud3 UTSW 4 138898032 missense possibly damaging 0.86
R3900:Otud3 UTSW 4 138896885 missense probably benign
R4890:Otud3 UTSW 4 138913749 missense probably damaging 1.00
R5534:Otud3 UTSW 4 138897583 missense probably damaging 1.00
R5769:Otud3 UTSW 4 138898110 missense possibly damaging 0.89
R5948:Otud3 UTSW 4 138897614 missense probably benign 0.00
R6235:Otud3 UTSW 4 138901901 missense probably damaging 1.00
R7121:Otud3 UTSW 4 138896756 missense probably benign 0.01
R7189:Otud3 UTSW 4 138909554 missense probably damaging 1.00
R7555:Otud3 UTSW 4 138901885 missense possibly damaging 0.77
R8034:Otud3 UTSW 4 138895800 missense probably benign 0.01
Z1177:Otud3 UTSW 4 138896775 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACACAGAGAAGCGGTTCCAAGC -3'
(R):5'- GCTGGAGCAATGGTTCCTATGCTG -3'

Sequencing Primer
(F):5'- CTAGACCTGTACTAGGGCAAGC -3'
(R):5'- GTTTCTTTCATTTAGTTCCAGATGC -3'
Posted On2014-05-14