Incidental Mutation 'R1723:Sfswap'
ID191607
Institutional Source Beutler Lab
Gene Symbol Sfswap
Ensembl Gene ENSMUSG00000029439
Gene Namesplicing factor SWAP
SynonymsSfrs8, 6330437E22Rik, 1190005N23Rik
MMRRC Submission 039755-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1723 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location129501221-129571384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129539694 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 401 (T401A)
Ref Sequence ENSEMBL: ENSMUSP00000062413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053737] [ENSMUST00000196698]
Predicted Effect probably benign
Transcript: ENSMUST00000053737
AA Change: T401A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062413
Gene: ENSMUSG00000029439
AA Change: T401A

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 157 1.15e-57 SMART
low complexity region 160 170 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
SWAP 209 262 3.94e-19 SMART
low complexity region 286 293 N/A INTRINSIC
low complexity region 333 352 N/A INTRINSIC
low complexity region 397 441 N/A INTRINSIC
SWAP 456 507 9.55e-18 SMART
low complexity region 513 532 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 598 607 N/A INTRINSIC
coiled coil region 631 686 N/A INTRINSIC
low complexity region 741 788 N/A INTRINSIC
low complexity region 797 821 N/A INTRINSIC
low complexity region 840 865 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
low complexity region 889 905 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196698
SMART Domains Protein: ENSMUSP00000142464
Gene: ENSMUSG00000029439

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 121 1.8e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199925
Meta Mutation Damage Score 0.0844 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human homolog of Drosophila splicing regulatory protein. This gene autoregulates its expression by control of splicing of its first two introns. In addition, it also regulates the splicing of fibronectin and CD45 genes. Two transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit a wobbly phenotype with inner ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 G T 6: 85,628,753 G2462C probably damaging Het
Anapc5 T C 5: 122,799,343 E464G probably damaging Het
Aoc3 T A 11: 101,336,435 V378E possibly damaging Het
Atp13a5 T A 16: 29,232,799 K1152I possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC027072 A T 17: 71,750,378 F768Y probably damaging Het
Calcoco1 C A 15: 102,719,553 G49C probably damaging Het
Cbwd1 A G 19: 24,948,094 V166A possibly damaging Het
Cd70 T C 17: 57,146,401 T88A possibly damaging Het
Cpeb1 C T 7: 81,436,226 R56Q probably benign Het
Dglucy A G 12: 100,842,679 Y212C probably damaging Het
Dnhd1 C A 7: 105,714,920 P4160T possibly damaging Het
Ecel1 T C 1: 87,154,421 D190G probably benign Het
Exoc6b A G 6: 85,069,344 L21P probably damaging Het
Fam110c A G 12: 31,074,395 R119G unknown Het
Fam198b T A 3: 79,936,663 N32K probably benign Het
Gm42791 C A 5: 148,959,501 probably benign Het
Hpcal4 A G 4: 123,190,739 I154V probably benign Het
Itgb1 A G 8: 128,726,038 D728G probably damaging Het
Kdm5d A T Y: 927,753 D701V probably damaging Het
Kif18a A G 2: 109,302,882 K448E probably damaging Het
Kif26a T C 12: 112,173,858 F507S possibly damaging Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lrrc43 T A 5: 123,492,213 probably benign Het
Map3k20 T C 2: 72,389,492 I256T probably damaging Het
Med29 T A 7: 28,392,705 probably benign Het
Mob3b A G 4: 34,954,026 C215R probably damaging Het
Mtf2 T C 5: 108,088,070 Y87H probably damaging Het
Myo18a G A 11: 77,853,314 R1834K probably damaging Het
Nlrc4 T A 17: 74,441,908 D779V probably damaging Het
Olfr638 T C 7: 104,003,311 F18S probably damaging Het
Otud3 T C 4: 138,898,018 T242A probably damaging Het
Pnliprp1 T A 19: 58,732,142 M150K possibly damaging Het
Polm T A 11: 5,834,776 Q227L probably benign Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppfia2 T A 10: 106,915,672 probably null Het
Rad51 T G 2: 119,123,814 M168R probably benign Het
Senp2 A G 16: 22,028,042 T266A probably benign Het
Slc35a4 C A 18: 36,682,735 T206K possibly damaging Het
Slc40a1 A G 1: 45,924,761 S23P probably damaging Het
Spef2 T C 15: 9,614,209 K1217R probably damaging Het
St18 A C 1: 6,810,685 probably benign Het
Tdrd6 T C 17: 43,628,327 D610G possibly damaging Het
Tmem163 C A 1: 127,551,371 R137L probably damaging Het
Tmem94 T A 11: 115,794,748 D942E probably damaging Het
Ttn T A 2: 76,750,410 I23380F possibly damaging Het
Uckl1 T A 2: 181,570,600 probably null Het
Vav2 T C 2: 27,318,964 D99G possibly damaging Het
Vmn2r30 T A 7: 7,334,260 I126F probably benign Het
Zbtb41 A T 1: 139,423,563 Q138L probably benign Het
Zfp599 T C 9: 22,258,065 Y37C probably damaging Het
Zfp784 T A 7: 5,035,783 T259S possibly damaging Het
Zfp954 T C 7: 7,115,838 S236G probably benign Het
Other mutations in Sfswap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Sfswap APN 5 129513233 missense probably damaging 1.00
IGL02064:Sfswap APN 5 129560796 missense probably benign 0.17
IGL02083:Sfswap APN 5 129539791 missense probably benign
IGL02378:Sfswap APN 5 129539604 missense probably damaging 1.00
FR4340:Sfswap UTSW 5 129569751 unclassified probably benign
FR4342:Sfswap UTSW 5 129569757 unclassified probably benign
FR4449:Sfswap UTSW 5 129569748 unclassified probably benign
FR4449:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569755 unclassified probably benign
FR4737:Sfswap UTSW 5 129569756 unclassified probably benign
FR4976:Sfswap UTSW 5 129569751 unclassified probably benign
I1329:Sfswap UTSW 5 129507137 unclassified probably benign
P0033:Sfswap UTSW 5 129539755 missense possibly damaging 0.60
R0184:Sfswap UTSW 5 129507189 missense probably damaging 0.97
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0414:Sfswap UTSW 5 129504051 missense possibly damaging 0.83
R0415:Sfswap UTSW 5 129504126 missense probably damaging 1.00
R0570:Sfswap UTSW 5 129503978 splice site probably benign
R1018:Sfswap UTSW 5 129554576 missense possibly damaging 0.91
R1173:Sfswap UTSW 5 129507143 critical splice acceptor site probably null
R1298:Sfswap UTSW 5 129541378 missense probably benign 0.14
R1783:Sfswap UTSW 5 129513240 missense possibly damaging 0.92
R1828:Sfswap UTSW 5 129513084 missense probably damaging 1.00
R1879:Sfswap UTSW 5 129541328 missense probably benign 0.01
R2078:Sfswap UTSW 5 129516107 missense possibly damaging 0.81
R2349:Sfswap UTSW 5 129569738 missense possibly damaging 0.87
R3757:Sfswap UTSW 5 129513234 missense probably damaging 1.00
R4093:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4094:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4095:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4785:Sfswap UTSW 5 129513083 missense probably damaging 1.00
R5139:Sfswap UTSW 5 129571009 missense possibly damaging 0.73
R5355:Sfswap UTSW 5 129539746 missense probably benign 0.09
R5481:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5600:Sfswap UTSW 5 129513158 missense probably damaging 1.00
R5686:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5906:Sfswap UTSW 5 129542043 missense probably benign 0.22
R6332:Sfswap UTSW 5 129571041 missense possibly damaging 0.91
R6738:Sfswap UTSW 5 129541441 missense probably damaging 0.98
R6743:Sfswap UTSW 5 129550819 nonsense probably null
R7371:Sfswap UTSW 5 129543241 missense probably benign 0.01
R7747:Sfswap UTSW 5 129550593 intron probably null
RF003:Sfswap UTSW 5 129569764 unclassified probably benign
RF042:Sfswap UTSW 5 129569743 unclassified probably benign
RF049:Sfswap UTSW 5 129569744 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCACTCTGCATGAAGTGCATGAAGG -3'
(R):5'- GGTCTGTGATCCAGATGAAGAACACTG -3'

Sequencing Primer
(F):5'- acagcctccccaaatgac -3'
(R):5'- ACTGGTGACGGCAGCAG -3'
Posted On2014-05-14